ID: 1113896619

View in Genome Browser
Species Human (GRCh38)
Location 13:113768585-113768607
Sequence GAGCAGGGCAGACCGTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113896619_1113896626 19 Left 1113896619 13:113768585-113768607 CCTGCTAACGGTCTGCCCTGCTC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1113896626 13:113768627-113768649 CAGAGTTAGGCCGTCTGAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 67
1113896619_1113896624 6 Left 1113896619 13:113768585-113768607 CCTGCTAACGGTCTGCCCTGCTC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1113896624 13:113768614-113768636 CCGAAGCAGCAACCAGAGTTAGG 0: 1
1: 0
2: 1
3: 6
4: 89
1113896619_1113896627 20 Left 1113896619 13:113768585-113768607 CCTGCTAACGGTCTGCCCTGCTC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1113896627 13:113768628-113768650 AGAGTTAGGCCGTCTGAGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1113896619_1113896628 21 Left 1113896619 13:113768585-113768607 CCTGCTAACGGTCTGCCCTGCTC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1113896628 13:113768629-113768651 GAGTTAGGCCGTCTGAGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1113896619_1113896629 28 Left 1113896619 13:113768585-113768607 CCTGCTAACGGTCTGCCCTGCTC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1113896629 13:113768636-113768658 GCCGTCTGAGCAGGGGTCACTGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113896619 Original CRISPR GAGCAGGGCAGACCGTTAGC AGG (reversed) Intronic
901639725 1:10687127-10687149 GAGCCGGGCAGAGCTTTAGATGG - Intronic
905168058 1:36094762-36094784 GAGCATGGCAGGCTGTGAGCAGG + Intergenic
915493317 1:156263910-156263932 AGGCAGGGCAGACAGTTAGAGGG + Intronic
920202986 1:204271708-204271730 GAGCAGGGAAGGCAGGTAGCTGG - Intronic
922723101 1:227908884-227908906 GAGCAGCACAGACCGTGAGGAGG - Intergenic
923461853 1:234215094-234215116 GAGCAGGGCAGTCAGTTGGCTGG - Intronic
1064686368 10:17866500-17866522 GAGCACGGCAGGCCTTCAGCAGG + Intronic
1070814070 10:79312360-79312382 GAGCAGGGCTGACCCTTTTCAGG - Intronic
1074385078 10:113010180-113010202 GGGCAGGGCAGCCAGTTAGGGGG + Intronic
1076096096 10:127736256-127736278 GAGCAGGGGAGGCCGAAAGCCGG + Intergenic
1077868070 11:6239547-6239569 GAGAAGGGCAGACCCTTGGTGGG + Intronic
1090210803 11:124920064-124920086 GAGCAGGGCAGATGGGTGGCAGG + Exonic
1097628679 12:62033012-62033034 ATGCAGGGCAGATCCTTAGCTGG - Intronic
1101067722 12:101040119-101040141 GATTAGGGCAGACTGTCAGCTGG + Intronic
1104055815 12:125229053-125229075 GAGGAGGGCAGACAGGGAGCTGG + Intronic
1113896619 13:113768585-113768607 GAGCAGGGCAGACCGTTAGCAGG - Intronic
1114454886 14:22847932-22847954 GAGCAGGGCATACCCATAGGGGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1121457330 14:94046813-94046835 GAGCAGAGCAGACGCTTTGCAGG + Exonic
1122624223 14:103075853-103075875 TAGGAGGGCAGACCCTCAGCCGG + Intergenic
1128732895 15:70033154-70033176 AAGCAGGGCAGCCCACTAGCTGG + Intergenic
1129179170 15:73860788-73860810 GAGCAGGACAGAGTGTGAGCAGG + Intergenic
1130846902 15:87756040-87756062 AAGCAGAGCAGATGGTTAGCTGG + Intergenic
1132391953 15:101445820-101445842 CAGCAGTGCTGACCCTTAGCAGG + Intronic
1133371837 16:5251116-5251138 GGGCTGGGGGGACCGTTAGCAGG - Intergenic
1137717782 16:50609440-50609462 GACCAGGGCAGACAGCTGGCTGG + Intronic
1143764751 17:9130209-9130231 GAGCAGGGCAGATTCTTTGCAGG + Intronic
1144642688 17:16946307-16946329 GAGCAGGACAGGCCGAGAGCAGG + Intronic
1148000254 17:44383643-44383665 GAGCCGGGCAGACCGAAAACTGG - Exonic
1151692366 17:75694428-75694450 GAGCAGCCCAGACCCTCAGCAGG + Intronic
1152540013 17:80970141-80970163 GAGGAGAGCAGACCCTGAGCTGG + Intergenic
1152667128 17:81577645-81577667 GAGCAGGACAGACGGTTGCCAGG - Intronic
1154271586 18:12925243-12925265 GAACAGGGCTGACCATTAGCTGG - Intronic
1154324391 18:13379671-13379693 GAGCAGGGAAGACTGTGGGCCGG + Intronic
1158852039 18:61504230-61504252 GAGCAGGGGAGTCGGTTAGGAGG + Intronic
1161417088 19:4153487-4153509 GGGGAGGGAAGACCGTTATCTGG - Intergenic
1162588990 19:11578557-11578579 GAGCAGGTCAGACCGGCCGCAGG - Intronic
1165142856 19:33712828-33712850 GATCAGGGCAGACACTGAGCAGG - Intronic
1165169159 19:33879184-33879206 GAGCAGGCCAGCCCGGTTGCTGG - Intergenic
1168145551 19:54418634-54418656 CAGCAGGGGAGACAGTGAGCAGG + Intronic
1168238030 19:55075894-55075916 GAGCAGGGCAGAGCCTGAGCAGG + Exonic
927723684 2:25404472-25404494 GAGCAGGGAAGACCTGTAGCAGG + Intronic
927989229 2:27435693-27435715 GAACAGAGCAGCCCGTAAGCGGG - Intronic
928202460 2:29257079-29257101 GACCAAGGCAGACCCTCAGCAGG - Intronic
931820745 2:65949445-65949467 GAGCATGGCAGCCCTTTTGCTGG + Intergenic
933565467 2:83945158-83945180 GTGCAGGGCAGTCCTTTAGAAGG + Intergenic
934764787 2:96874641-96874663 GAGCAGGGCAGCCCGAGGGCGGG + Intergenic
938140531 2:128791282-128791304 GAGCAGGGCAGAGTGGGAGCTGG - Intergenic
938771721 2:134506622-134506644 GAGCAGGGCTGGCTGTTAGGAGG - Intronic
944656820 2:201883790-201883812 CAGCAGGGCAGGACGTCAGCTGG + Intronic
944962341 2:204889246-204889268 GAGCAGAGAAGACCTTTAGAAGG - Intronic
945260299 2:207836889-207836911 GAGCAGGGCAGAGCCTTGGCTGG + Intronic
945295821 2:208170453-208170475 GAGCAGGGGAGACTTTAAGCAGG + Intronic
946389347 2:219405907-219405929 GAGCAGAGCAGAATGTTAGGAGG + Intergenic
946405089 2:219488267-219488289 GTGCAGGGCAGGCCGCTGGCAGG - Exonic
948409692 2:237749536-237749558 CAGCAGGGCGGACCGTGTGCCGG + Intronic
948428423 2:237902638-237902660 GTGCAGGGCAGACAGGGAGCGGG - Intronic
948879307 2:240848261-240848283 GAGCAGGGCTGTGCGTTAGAGGG + Intergenic
1169266764 20:4171937-4171959 GAGCAGGGAAGGCAGGTAGCTGG + Intronic
1175775351 20:61649747-61649769 GAGCATGGCGGGCCGTGAGCAGG + Intronic
1179781249 21:43702376-43702398 GAGCTGGGAAGCCCGTCAGCAGG + Intergenic
1181473794 22:23156512-23156534 GGGCAGGGCTCACCGTCAGCAGG + Intronic
1184499368 22:44862487-44862509 GAGCAGGGCAGCCCCTTTGCAGG + Exonic
951879197 3:27463786-27463808 GAGATGGGCAGCCTGTTAGCAGG + Intronic
953331174 3:42053873-42053895 GAGTAGGGCAGACTGATTGCAGG - Intronic
954759304 3:52862314-52862336 GAGCAGGGAAGCCTGTTAGGAGG - Intronic
957755928 3:84487492-84487514 AAGCAGTGCAGTCCCTTAGCCGG + Intergenic
969105404 4:4803754-4803776 GAGCAGAGAAGGCCGTTTGCTGG + Intergenic
972357077 4:38289807-38289829 GAGAAGGGCAGACCCCCAGCAGG + Intergenic
972399243 4:38685126-38685148 GAGCGGGGAAGACTGTTACCAGG + Intronic
977294063 4:95192332-95192354 GAGCAGGGGAGAAGGTGAGCAGG - Intronic
977294130 4:95192603-95192625 GAGCAGGGGAGAAGGTGAGCAGG - Intronic
981049990 4:140300306-140300328 GAGCAGGGCAGACTGAGATCAGG - Intronic
981746680 4:148058926-148058948 GAGCTGGGAAGACAGTAAGCAGG - Intronic
988509791 5:31855290-31855312 GAGAAGGGCAGACGCTTAGGTGG - Intronic
988906765 5:35798454-35798476 GAGGAGGGCAGGGAGTTAGCTGG - Intronic
992190568 5:74287658-74287680 GAGCATGGCAGCCCCTAAGCAGG - Intergenic
997230758 5:132240659-132240681 GAGCAGGGCATACCAATTGCAGG - Intronic
997476353 5:134144748-134144770 GAGCAGGGCAGAGGGCGAGCAGG - Intronic
997612940 5:135227840-135227862 GAGCAGAGCAGACAGCTGGCAGG - Intronic
1017879973 6:158555141-158555163 GAACAGGGAAGAATGTTAGCAGG + Intronic
1019029076 6:168994957-168994979 GAGCAGGGCTGACCGTGGGCAGG + Intergenic
1019212928 6:170421288-170421310 GGGCAGGGCAGACAGTAAGACGG + Intergenic
1020459591 7:8413430-8413452 GAGGAGGCCAGACCCTTTGCAGG - Intergenic
1029590474 7:101503676-101503698 GAGCCATGCAGACCCTTAGCTGG - Intronic
1032719725 7:134540835-134540857 AAGGAGGGCAGACAGTGAGCAGG - Intronic
1032724623 7:134579300-134579322 AAGGAGGGCAGACAGTGAGCAGG - Intronic
1033603481 7:142907817-142907839 GACCAGGGCAGAGAGATAGCTGG + Intergenic
1034257443 7:149732438-149732460 GAGCAGGGCAGAGCCACAGCTGG + Intronic
1034934428 7:155189675-155189697 GAGCTGGGCAGACCCTGTGCTGG + Intergenic
1035287426 7:157815223-157815245 GAGCAGGGCCAGCCGTTTGCAGG + Intronic
1037686487 8:21143967-21143989 GAGCCGGGCACACCCTGAGCAGG - Intergenic
1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG + Intergenic
1041445001 8:57941597-57941619 GAGCAGGGCAGCCCCTCAGCAGG + Intergenic
1044358324 8:91252511-91252533 GAGAAGGACAGACAGGTAGCAGG - Intronic
1048226824 8:132595838-132595860 GAGCAGGGCAAACCGTGAGAAGG + Intronic
1048547336 8:135399289-135399311 GGGCAGGGCTGACAGTCAGCTGG - Intergenic
1049367039 8:142244833-142244855 GAGCAGGGCAGACCGGCAAGGGG + Intronic
1049514196 8:143044782-143044804 TAGCAGCGCAGACCCTGAGCTGG + Exonic
1050096970 9:2077033-2077055 GATCAGGGCAGACTGCTAGGAGG - Intronic
1050669044 9:7975468-7975490 GAGCAGGTTAAACTGTTAGCAGG + Intergenic
1057217848 9:93239238-93239260 GAGCAGAGCAGAGGGTGAGCTGG - Intronic
1057618779 9:96617926-96617948 GGGAAGGGCACAACGTTAGCGGG + Intronic
1062626663 9:137446087-137446109 GAGCAGGGCAGGCAGGTCGCTGG + Intergenic
1194666394 X:96682017-96682039 GAGCTGGGGAGACTGTTGGCAGG - Intergenic
1200152651 X:153958841-153958863 GAGCAGGGCAGCCCCTGGGCAGG - Intronic
1202369008 Y:24184967-24184989 GAGCAGGGCAGACTCTTTGTGGG - Intergenic
1202501777 Y:25485150-25485172 GAGCAGGGCAGACTCTTTGTGGG + Intergenic