ID: 1113897728

View in Genome Browser
Species Human (GRCh38)
Location 13:113776494-113776516
Sequence CAGCTCGGACAGCAGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113897728_1113897737 26 Left 1113897728 13:113776494-113776516 CCCACCTGCTGCTGTCCGAGCTG 0: 1
1: 1
2: 3
3: 40
4: 235
Right 1113897737 13:113776543-113776565 GAGCTGCTGGCTCCGTCCCACGG 0: 1
1: 0
2: 4
3: 16
4: 158
1113897728_1113897732 13 Left 1113897728 13:113776494-113776516 CCCACCTGCTGCTGTCCGAGCTG 0: 1
1: 1
2: 3
3: 40
4: 235
Right 1113897732 13:113776530-113776552 TGACCCCACCTCAGAGCTGCTGG 0: 1
1: 0
2: 2
3: 39
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113897728 Original CRISPR CAGCTCGGACAGCAGCAGGT GGG (reversed) Intronic
900032642 1:382054-382076 CAGCCAGCACAGCAGCAGGTGGG + Intergenic
900053400 1:611116-611138 CAGCCAGCACAGCAGCAGGTGGG + Intergenic
900557919 1:3289308-3289330 CAGCTTGGAAATCTGCAGGTGGG + Intronic
901525957 1:9823674-9823696 CAGCCCGGCCAGCAGCAGCCGGG + Exonic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903731573 1:25500295-25500317 CATCTCGGCCTGCATCAGGTGGG + Intergenic
907460941 1:54605155-54605177 CAGGTCCGAGAGCAGCAGGAAGG - Exonic
913163793 1:116167794-116167816 CACCTCTGAGAGCAGCACGTTGG - Intergenic
913441907 1:118907208-118907230 CATCTAGTACAGCTGCAGGTGGG - Intronic
914419547 1:147516825-147516847 TGGCTTGGGCAGCAGCAGGTAGG - Intergenic
914980606 1:152411317-152411339 CAGCACAAAGAGCAGCAGGTTGG + Intronic
915034450 1:152910497-152910519 GAGCTCCCACAGCAGCAGGAGGG + Exonic
915034600 1:152911268-152911290 GAGCTCCCAGAGCAGCAGGTAGG + Exonic
915142359 1:153775505-153775527 CAGCAGGGGCAGCAGCAGGAGGG - Exonic
915240019 1:154514628-154514650 CAGGTGGGACAGCAGTGGGTTGG - Intronic
915261788 1:154682047-154682069 GAGCTGGGGCAGCGGCAGGTGGG - Intergenic
915550168 1:156627806-156627828 CAGCTCAGCCAGCAGGAGGATGG + Intergenic
916788554 1:168104614-168104636 CAACACGGACAGCAGGAAGTTGG + Exonic
922810859 1:228414824-228414846 CACCTTGGTCAGCAGCCGGTTGG + Exonic
923087099 1:230710227-230710249 CACCGTGGACAGCAGCAGCTGGG + Exonic
924394740 1:243606873-243606895 CAGCTGGGACTGAAGCAGTTGGG - Intronic
1063076298 10:2720311-2720333 GAGCTCAGACAGCAGCAGTGTGG - Intergenic
1063125921 10:3136707-3136729 CAGCACGCACTGGAGCAGGTGGG - Exonic
1067655605 10:48189223-48189245 CAGCACAGACAGGAGCATGTGGG + Intronic
1067753458 10:48986583-48986605 CAGCACTGACAGCAGCAGGCTGG + Intergenic
1069572313 10:69501760-69501782 CAGGTCGCACAACAGGAGGTGGG + Intronic
1069880956 10:71592904-71592926 CAGCTGGGACAGCAGCTGAAAGG - Intronic
1069959257 10:72070073-72070095 GACCTCGGACAGGTGCAGGTGGG - Intronic
1070739829 10:78895505-78895527 CAGCAAGGACAGCTACAGGTTGG + Intergenic
1071338736 10:84623280-84623302 CACCTTGGAGAGCAGCAGGCTGG + Intergenic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1073218637 10:101851493-101851515 CAGCTCTGACAGAAGGGGGTTGG + Intronic
1073242455 10:102067227-102067249 GAGCTGGCACAGCAGCAGGGCGG + Exonic
1076128686 10:127995972-127995994 CATCTAAGACAGCAGCATGTAGG - Intronic
1076244658 10:128937368-128937390 CAGCTCTGAGAGAAGCGGGTGGG + Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076686511 10:132200614-132200636 CAGCCCGGACAGTGGCGGGTGGG + Intronic
1076755751 10:132570805-132570827 CTGCCAGGACAGCAGGAGGTGGG + Intronic
1077536393 11:3126796-3126818 AAGCTGGGACAGGAGCTGGTAGG + Intronic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1081859005 11:46321303-46321325 CGGCTTGGGCAGCAGCAGGGGGG - Exonic
1082004847 11:47413816-47413838 CGGCCAGGACAGCAGCAGGGAGG - Intronic
1084506704 11:69572936-69572958 CAGCCCAGGCAGCAGGAGGTTGG - Intergenic
1085328094 11:75623999-75624021 CAGCCAGGCCAGCAGCGGGTGGG + Intronic
1085938140 11:81175182-81175204 CAGTTGGGAAAGCAGCTGGTGGG + Intergenic
1086997330 11:93372921-93372943 CAGCTCAGACAGTCGGAGGTGGG - Intronic
1087774499 11:102245051-102245073 CAGCTGGGACAGGGCCAGGTGGG - Intergenic
1090094540 11:123730096-123730118 CAGCAAGGAGAGCTGCAGGTGGG - Intronic
1090452697 11:126820708-126820730 CAGCGGGCACAGCAGCAGGCTGG + Intronic
1091137984 11:133209977-133209999 CAGCTCACCCAGGAGCAGGTAGG + Intronic
1097574090 12:61369677-61369699 CAGCTCAGACTGCAGCTGTTTGG + Intergenic
1098197464 12:68017131-68017153 CAGAAGGAACAGCAGCAGGTAGG + Intergenic
1098521653 12:71440238-71440260 CAGCTCCGAGAGCCCCAGGTCGG - Exonic
1098768041 12:74514723-74514745 CAGCTCGGCCAGGAGCTGGCCGG + Intergenic
1099973334 12:89523392-89523414 CTGCTCGGGCAGCAGAAGTTTGG - Exonic
1102788106 12:115620607-115620629 CAGCACGGCAAGCAGCAGGTAGG + Intergenic
1102979122 12:117227531-117227553 CAGCTGGGTCAGGAGCAGGGTGG + Exonic
1103366132 12:120384788-120384810 CAGCTGGGACAGCTGCAGGCAGG - Intergenic
1103731914 12:123033370-123033392 CAGCCAGGACTGCAGCAAGTGGG + Intronic
1105669833 13:22600806-22600828 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
1105825228 13:24116429-24116451 AGGCCTGGACAGCAGCAGGTGGG + Intronic
1107069745 13:36256928-36256950 CAGGTGGGCCAGCAGCAGCTGGG + Intronic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113425659 13:110206358-110206380 CTGCTCTGAGAGCAGCAGGTTGG - Intronic
1113632264 13:111896444-111896466 CAGCTCCGAGAGCAGGAGGCTGG + Intergenic
1113744106 13:112730839-112730861 CCGCTGTGACGGCAGCAGGTCGG + Intronic
1113897728 13:113776494-113776516 CAGCTCGGACAGCAGCAGGTGGG - Intronic
1114532245 14:23403306-23403328 CAGCAGGGACAGCAGTGGGTGGG + Intronic
1114587161 14:23825622-23825644 CAGCTGGCTCAGCAGCAGGCTGG + Intergenic
1114655008 14:24310738-24310760 CAGCGCCGCCAGCAGCAGGAAGG - Exonic
1117474867 14:56084007-56084029 AGGCTAGGCCAGCAGCAGGTAGG - Intergenic
1121451213 14:94009335-94009357 CAGCTCAGACACCTGCAGGATGG - Intergenic
1121578148 14:95005768-95005790 CAGCTCTGGAAGGAGCAGGTAGG - Intergenic
1122840873 14:104461949-104461971 CAGCGAGGACAGCGGCAGGGGGG + Intergenic
1122931975 14:104937441-104937463 CAGCTGGGCCAGCAGAAGCTAGG - Exonic
1122970583 14:105150557-105150579 CAGCTCCCAGAGCAGCAGGTGGG + Intronic
1202904042 14_GL000194v1_random:58457-58479 CTTCTGGGCCAGCAGCAGGTCGG + Intergenic
1126661851 15:51040023-51040045 CAGGCCGCACAGCAGGAGGTGGG + Intergenic
1129413842 15:75363979-75364001 CAGGTAGGACAGCAGCTGGTTGG - Exonic
1129456182 15:75677182-75677204 CAGCTGGGACTGCAGGAAGTGGG + Exonic
1130103140 15:80909145-80909167 CATATGGGACAGCAGCTGGTGGG + Exonic
1130119874 15:81038587-81038609 CAGCACTGACAGAAGCAGGAGGG + Intronic
1132501103 16:285065-285087 CAAACTGGACAGCAGCAGGTGGG - Exonic
1135171968 16:20192538-20192560 CAGCTGTGACAGCAACATGTGGG + Intergenic
1137277100 16:46942795-46942817 CAGCCCAGAGAGCTGCAGGTTGG + Intergenic
1138087053 16:54142766-54142788 AAGATCGGAGAGCAGCAGGAAGG + Intergenic
1138179023 16:54930188-54930210 CTGCGCCGGCAGCAGCAGGTGGG - Intergenic
1141126737 16:81406032-81406054 CAGCTTGCCCAGCAGCAGCTGGG - Intergenic
1141850287 16:86640458-86640480 CAGCCCAGACAGCAGGGGGTTGG + Intergenic
1141859141 16:86704637-86704659 CAGCGGGGACAGGAGCTGGTGGG + Intergenic
1142160136 16:88553080-88553102 CACCTCTGACAGCAGCGGGGAGG + Intergenic
1142243251 16:88956649-88956671 CAGGTGGGGCAGCTGCAGGTTGG - Intronic
1142250707 16:88990528-88990550 CAGGTCGGACAACAGCAGGCCGG - Intergenic
1143950978 17:10631915-10631937 CACCTCGGCCTGCAGCAGGTTGG + Exonic
1146421969 17:32695348-32695370 CAGGCCGCACAGCAGCAGGTGGG - Intronic
1146588877 17:34110485-34110507 CAGCTGTGCCAGCAGCAGGCGGG + Intronic
1147512638 17:41084525-41084547 CAGCTGGGGCGGCAGCAGGTGGG - Exonic
1147513871 17:41097699-41097721 CAGCTGGGGCGGCAGCAGTTGGG + Exonic
1147513888 17:41097804-41097826 CAGCTAGGGTGGCAGCAGGTGGG + Exonic
1147513900 17:41097879-41097901 CAGCTGGGGCGACAGCAGGTGGG + Exonic
1147514371 17:41101887-41101909 CAGCTGGGGTGGCAGCAGGTGGG + Exonic
1147514393 17:41102007-41102029 CAGCTGGGGCGGCAGCAGGTGGG + Exonic
1147514827 17:41105827-41105849 CAGCTGGGGCGGCAGCAGTTGGG - Exonic
1147515967 17:41117900-41117922 CAGCTGGGGTGGCAGCAGGTGGG + Exonic
1147516000 17:41118110-41118132 CATCTGGGGCGGCAGCAGGTGGG + Exonic
1147516590 17:41123689-41123711 CAGCTGGGGCGGCAGCAGGTGGG + Exonic
1147516611 17:41123809-41123831 CAGCTGGGGCGGCAGCAGGTGGG + Exonic
1147516633 17:41123929-41123951 CAGCTGGGGCGGCAGCAGGTGGG + Exonic
1147517956 17:41140057-41140079 CAGCTGGGACGGCAGCAGGTTGG + Exonic
1147517972 17:41140162-41140184 CAGCTGGGACGGCAGCAAGTGGG + Exonic
1147517994 17:41140294-41140316 CAGCTGGGACGGCAGCAGGTGGG + Exonic
1147518891 17:41149394-41149416 CAGCTGGGACGGCAGCAAGTGGG + Exonic
1147518925 17:41149589-41149611 CAGCTAGGGTGGCAGCAGGTGGG + Exonic
1147519837 17:41160318-41160340 TAGCTGGGGCAGCAGCAGGTGGG + Exonic
1147521516 17:41177851-41177873 CAGCTGGGGCGGCAGCAGGTGGG + Exonic
1147521536 17:41177971-41177993 CAGCTGGGGCTGCAGCAGGTGGG + Exonic
1147906776 17:43828400-43828422 CAGGCCGGACTGCAGCAGGACGG + Intronic
1148674650 17:49438414-49438436 CAGCTCGGCCAGCTGCTGGAGGG + Intronic
1149122718 17:53189657-53189679 CTGCTGGGACAGCAGCAGCATGG - Intergenic
1150206492 17:63412500-63412522 CAGCTGGGACAGCGGCAGCAGGG - Intronic
1150571530 17:66391145-66391167 GAGCTTGGAGAGCAGCGGGTGGG + Intronic
1150983427 17:70169267-70169289 CAGCTGGGACAGCAGCAGGTGGG - Intronic
1151650968 17:75469258-75469280 CAGCTGGGACAGCAGCAGGGTGG - Intronic
1154031808 18:10759702-10759724 CACCTCGGCAAGGAGCAGGTGGG + Exonic
1155326612 18:24671166-24671188 CAGCATGGACAGCAGCAGTCTGG + Intergenic
1157851599 18:51058190-51058212 CAGCCAGGACAGCAGCAGAATGG + Exonic
1157904606 18:51558352-51558374 CAGGCCGCACAGCAGTAGGTGGG + Intergenic
1161217945 19:3104145-3104167 CAGCCCTGACAGCAGGAGCTGGG - Intronic
1161720387 19:5899012-5899034 CTGCTGGGCCAGGAGCAGGTGGG - Intronic
1163546417 19:17943609-17943631 CAGCTGCGACAGCCGCATGTTGG - Exonic
1166584144 19:43930332-43930354 ACACTCAGACAGCAGCAGGTGGG + Intronic
1168340922 19:55622483-55622505 CAGCTCGGAAACCAGCCGGAAGG + Exonic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
927054646 2:19357401-19357423 CAGCTCAGGCAGTAGCGGGTTGG - Intronic
927163605 2:20294371-20294393 CAGCCTGGACAGCAACAGGTAGG - Exonic
929788278 2:45007159-45007181 CAGCTCGGAGACCAGAAGCTTGG + Intronic
929821160 2:45274817-45274839 CAGCTCAGACAGCAGGTGGAAGG + Intergenic
931223970 2:60313314-60313336 CATCTCTGACAGCAGTAGGATGG - Intergenic
931782120 2:65587773-65587795 CAGCTCTGAGAGGAGCGGGTGGG + Intergenic
932254564 2:70273129-70273151 CAGCTCTGGCAGGAGCAGTTGGG + Intronic
934188222 2:89764293-89764315 CAGCTGGAGCAGCAGCTGGTGGG - Intergenic
937066817 2:119023804-119023826 CAGCTGGGACTGCAGGTGGTGGG - Intergenic
938410428 2:131059285-131059307 CAGCTCAGAGAGGGGCAGGTGGG + Intronic
945673903 2:212832870-212832892 CAGGTGGGCCAGCAGCAGCTGGG - Intergenic
945791389 2:214309871-214309893 CAGCTGGGACAGCAGGTTGTGGG + Intronic
946153653 2:217792958-217792980 CAGCTCAGACAGCACCTGGCAGG - Intergenic
947533398 2:230926507-230926529 CTGCTGGGACAGTAGCAGGGAGG + Intronic
1169378749 20:5088441-5088463 CAGCTAGGTCAGCAGAAGGGTGG + Intronic
1169893205 20:10475183-10475205 CAGCTCGGCCACCATCAGTTTGG + Intronic
1171120863 20:22568129-22568151 CAGCTCGGGCTGGAGCAGGGTGG + Intergenic
1171480661 20:25453601-25453623 CAGCTCCTTCAGCAGCAGGTCGG + Exonic
1174065326 20:47860556-47860578 CACCTGACACAGCAGCAGGTGGG + Intergenic
1174933933 20:54846491-54846513 CAGCTAGGACAAAAGCAGGCAGG - Intergenic
1175510854 20:59525158-59525180 AAGCTCAGAGAGCACCAGGTAGG - Intergenic
1175722504 20:61295781-61295803 CAGGCCGGGCAGCAGCTGGTGGG - Intronic
1176623414 21:9073224-9073246 CTTCTGGGCCAGCAGCAGGTCGG + Intergenic
1178413376 21:32384080-32384102 CAGCAAGGACAGTAGCAGGCAGG + Intronic
1179383623 21:40921553-40921575 CTGCTTGGAAAGGAGCAGGTGGG + Intergenic
1179887443 21:44320247-44320269 CAGCTCGGACCCCAGCAGGAGGG - Intronic
1181175490 22:21032526-21032548 CGGCTGCGGCAGCAGCAGGTGGG - Exonic
1181466793 22:23114739-23114761 CAGCTGGCAGAGCAGGAGGTTGG + Intronic
1181676873 22:24460524-24460546 AAGCTTGGACACCAGCAGGGTGG - Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182355570 22:29720981-29721003 CTGCTCGGGCAGCAGCAGAAGGG + Intronic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1183280373 22:36929022-36929044 GAGCTTGGACAGCAGGAGGGGGG + Intronic
1183357898 22:37369282-37369304 CAGCTGGGGCAGCAGCAGTGGGG - Exonic
1183929256 22:41226795-41226817 CACCACTGACAGCAGCAGGCAGG - Intronic
1184045727 22:41971273-41971295 CAGATCAGTCTGCAGCAGGTAGG + Intergenic
1184223739 22:43117050-43117072 TAGCTCTGAAAGCCGCAGGTGGG + Intronic
1184912368 22:47544801-47544823 CTGATTGGACAGCAGCAGGCTGG + Intergenic
949832161 3:8226409-8226431 AAGCTCGGACAGGAGAAGGATGG - Intergenic
951803562 3:26623101-26623123 CAGCTCGGCTTGCAGCTGGTTGG + Exonic
953359169 3:42280053-42280075 GAGCTGGAACAGCAGCAGCTGGG - Intergenic
960803970 3:121564943-121564965 CAGCTGGCAGAGCAGCAGGAAGG + Intergenic
961655387 3:128438888-128438910 CAGCAGGGGCAGCGGCAGGTGGG + Intergenic
961768666 3:129231973-129231995 AACCTCGGACAGCACCAGGTTGG - Intergenic
962751021 3:138434881-138434903 GAGCTCGGGCAGCAGCTGGCTGG - Exonic
967093836 3:186160289-186160311 CAGCTAGGACTGAACCAGGTAGG + Intronic
967777043 3:193395462-193395484 CAGCTGGGACTGAAGCAGCTGGG + Intergenic
968912381 4:3482888-3482910 CAGCCGGGACGGCAGCAGGTGGG + Intronic
969245336 4:5928408-5928430 TACCTCGGACAGCAGCAGCTGGG + Intronic
969429283 4:7144893-7144915 CAGCAAGGACAGGAGCAGGAGGG - Intergenic
969474220 4:7412135-7412157 CAGCTCCTACAGCAGAAGCTGGG - Intronic
969703167 4:8778819-8778841 CAGCTCAGAGACCAGCAGGGCGG + Intergenic
971643903 4:29171565-29171587 CATTTCAGACAGCAGCAGGTGGG + Intergenic
972213054 4:36861997-36862019 CAGCTACAACTGCAGCAGGTTGG + Intergenic
973903227 4:55499619-55499641 CAGGCCGCACAGCAGGAGGTAGG - Intronic
975482924 4:74901943-74901965 CAGGTGGGACAACATCAGGTTGG - Intergenic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
979576517 4:122297905-122297927 CAGCAGGGACAGCAGGAGGGAGG + Intronic
984866042 4:184281597-184281619 GAGCTGGAACAGCAGCAGGTAGG + Intergenic
985489522 5:171254-171276 CTGCACGGGCCGCAGCAGGTAGG - Exonic
985632075 5:1018941-1018963 CATCTAGGGGAGCAGCAGGTGGG + Intronic
986319395 5:6615678-6615700 CTGGAAGGACAGCAGCAGGTGGG + Intronic
986548754 5:8929028-8929050 CAGCTCAGACAGCTGCATGTAGG + Intergenic
991552477 5:67855661-67855683 CAGTTCAGGCAGCAGAAGGTAGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994841733 5:104932632-104932654 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
997304093 5:132825787-132825809 CAGCGCGTACAGCAGCGGGGTGG + Exonic
998092650 5:139380233-139380255 CAGCTCGGTCGCCAGCAGCTTGG + Exonic
999683318 5:154080272-154080294 CAGCCCAGCCAGCAGCAGTTTGG + Intronic
1000572733 5:162935494-162935516 CAGCTGTGGTAGCAGCAGGTTGG + Intergenic
1001087801 5:168714086-168714108 CAGCTAGGACAGCAGGAAGATGG + Intronic
1001934634 5:175695424-175695446 CAGCTCGCGCAGGAGTAGGTAGG + Intergenic
1002700755 5:181122779-181122801 TAGCTCGGACTGCAGTAGCTAGG + Intergenic
1002741178 5:181436814-181436836 CAGCCAGCACAGCAGCAGGTGGG - Intergenic
1003323829 6:5076892-5076914 CACCTCTGACAGTAGCAGGGTGG + Intergenic
1003328380 6:5109774-5109796 CAGCTCTGCCACCAGCAGGCAGG - Intronic
1004330584 6:14717039-14717061 CAGCCAGGACAGCAGCAAGTAGG + Intergenic
1006375449 6:33669240-33669262 GAGCTCTGACAGCCTCAGGTGGG + Intronic
1007165054 6:39823374-39823396 GAGCTTGGAGACCAGCAGGTTGG - Intronic
1008302588 6:49859355-49859377 CATCTCTGGCAGCAGCAGCTAGG - Intronic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1013353145 6:109323992-109324014 CAGCTGGGGCAGGAGCAGGCTGG + Intergenic
1014847753 6:126299619-126299641 AACCTCAAACAGCAGCAGGTGGG - Intergenic
1018086237 6:160303515-160303537 CAGCTGTGAAAGCAGCAGGGAGG - Intergenic
1018805120 6:167253318-167253340 CAGCTAGGAAATAAGCAGGTAGG - Intergenic
1018978543 6:168583684-168583706 CAGCATGGCCAGCAGGAGGTTGG - Intronic
1019246293 6:170712511-170712533 CAGCCAGCACAGCAGCAGGTGGG - Intergenic
1019315062 7:380518-380540 CAGCTCGGACAGAGGGAGGGAGG + Intergenic
1019454986 7:1122357-1122379 CAGCACTGACAGCAGCAGGGAGG + Intronic
1019729508 7:2622533-2622555 CAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729512 7:2622548-2622570 CAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729516 7:2622563-2622585 GAGCTGGGACAGGAGCAGCTGGG - Intergenic
1021992638 7:26152614-26152636 CAGCTCGTCCTGCAGCAGGGTGG - Exonic
1023984931 7:45088850-45088872 CGCCTCGGGCAGCAGCAGCTCGG + Exonic
1024177874 7:46860192-46860214 GAGCTGGGAAAGGAGCAGGTGGG - Intergenic
1024209359 7:47190536-47190558 CAGCCCGGAGAGCAGCATGGGGG - Intergenic
1024701325 7:51907116-51907138 AGGCTCTGACAGCAGCAGGCAGG + Intergenic
1025997497 7:66537219-66537241 CACCTCAGAGAGCTGCAGGTGGG - Intergenic
1026990375 7:74581695-74581717 CATCTCGGAGAGCTGCAGGTGGG - Intronic
1030373296 7:108725371-108725393 CAACTCAGAAAGCAGCAGCTAGG - Intergenic
1031520234 7:122755950-122755972 CAGATGGGACAGTAGCAGCTTGG - Intronic
1032267513 7:130379759-130379781 CAGCCCGGGCAGCAGCAGCAGGG - Intergenic
1033777528 7:144629312-144629334 CAGCTGGGACTGAAGCAGCTAGG - Intronic
1034076918 7:148240911-148240933 CAGCTAGGATAAAAGCAGGTAGG - Intronic
1034383604 7:150720202-150720224 CACCACGGGCAGCCGCAGGTGGG + Exonic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1035294773 7:157860844-157860866 CAGCTCAGGCAGCAGCTGGCCGG + Intronic
1035501779 8:95178-95200 CAGCCAGCACAGCAGCAGGTGGG + Intergenic
1036031759 8:4981709-4981731 GGGCACGGACATCAGCAGGTGGG - Intronic
1036703553 8:11030099-11030121 GAGCTGGGACAGCTGCAGCTAGG - Intronic
1036758546 8:11490392-11490414 CAGCTCTGGCAGCAGAAGATGGG - Intergenic
1037138663 8:15494076-15494098 CAGCTGGTATAGCAGCAGGCTGG - Intronic
1037189226 8:16101272-16101294 CAGTTCTGACAGTACCAGGTTGG + Intergenic
1037837737 8:22224151-22224173 CAGCCAGGACAGGAGCAGGAAGG + Intronic
1040835260 8:51724113-51724135 CATCTAAGACAGGAGCAGGTTGG + Intronic
1042920533 8:73915031-73915053 CAGCCGGGGCAGCCGCAGGTTGG + Intergenic
1043784496 8:84380934-84380956 CAGCTCAGACAGAAGCTGGGTGG + Intronic
1046029691 8:108768725-108768747 CAGACCTGAGAGCAGCAGGTAGG - Intronic
1047058050 8:121190041-121190063 TGGCTCAGACAGCACCAGGTGGG - Intergenic
1047923407 8:129657899-129657921 CAGCTGGAACAGGAGCAGCTGGG + Intergenic
1049001423 8:139827682-139827704 CAGCCAGGACAGCAGCAAGAGGG + Intronic
1049426482 8:142540198-142540220 GAGCTGGGACAGCCCCAGGTGGG + Intronic
1049682851 8:143927405-143927427 CAGCTGCGGCAGGAGCAGGTGGG - Exonic
1049759013 8:144323489-144323511 CAGTGCGGCCAGCAGCATGTGGG + Intronic
1049804110 8:144531183-144531205 CAGGGCAGAGAGCAGCAGGTGGG + Intronic
1051049863 9:12918994-12919016 CAGCTAGAGCAGTAGCAGGTAGG + Intergenic
1051078237 9:13265659-13265681 CACCTCCGACAGCAGTTGGTAGG - Intronic
1055411001 9:76029117-76029139 CAGCTCAGACAGCAGCAAAGCGG - Intronic
1056068512 9:82961729-82961751 TTGCCCTGACAGCAGCAGGTTGG - Intergenic
1056947110 9:91007314-91007336 CAGCTGGGGCAGAAGCAGCTGGG - Intergenic
1059321243 9:113471699-113471721 CTGCTCGGACAACTGCAGGTAGG - Intronic
1059430552 9:114247657-114247679 CAGCTTGGACAGTAGCGGGAAGG + Intronic
1060758206 9:126227807-126227829 CAGCGCGGGCAGCTCCAGGTCGG - Intergenic
1061777180 9:132973309-132973331 CAGCTCCGGCAGGTGCAGGTGGG - Intronic
1061800022 9:133108707-133108729 CAGCTGGGCCAGGAGAAGGTGGG + Exonic
1062118737 9:134822722-134822744 CAGCTCAGACAGCCGCGGGGGGG - Intronic
1062425186 9:136502995-136503017 CAGCTGTGACCGCCGCAGGTGGG + Intronic
1203746598 Un_GL000218v1:43652-43674 CTTCTGGGCCAGCAGCAGGTCGG + Intergenic
1203563511 Un_KI270744v1:75828-75850 CTTCTGGGCCAGCAGCAGGTCGG - Intergenic
1203607057 Un_KI270748v1:67894-67916 CAGCCAGCACAGCAGCAGGTGGG - Intergenic
1185643466 X:1600888-1600910 CAGGACGGGCTGCAGCAGGTCGG - Exonic
1186833280 X:13412395-13412417 CAACTGGGGCAGCAGCGGGTCGG + Intergenic
1187154783 X:16712529-16712551 GAGCTGGGCCAGCAGCAGGGAGG - Intronic
1192201772 X:69070965-69070987 CAGCTCTGTCAGCATCCGGTGGG - Intergenic
1196285250 X:113871890-113871912 CAGCTCTGACAGCAGCCAGGAGG + Intergenic
1202368425 Y:24182206-24182228 CAGCTAGGACAGAAGCAGCTGGG - Intergenic
1202502360 Y:25487911-25487933 CAGCTAGGACAGAAGCAGCTGGG + Intergenic