ID: 1113900877

View in Genome Browser
Species Human (GRCh38)
Location 13:113797225-113797247
Sequence CCCCTGGCCGGGGCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113900868_1113900877 2 Left 1113900868 13:113797200-113797222 CCTCTTGGTTAGAAACAAAGCAG 0: 1
1: 0
2: 1
3: 19
4: 156
Right 1113900877 13:113797225-113797247 CCCCTGGCCGGGGCCTCCCAGGG 0: 1
1: 0
2: 2
3: 55
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113900877 Original CRISPR CCCCTGGCCGGGGCCTCCCA GGG Intronic