ID: 1113901246

View in Genome Browser
Species Human (GRCh38)
Location 13:113799368-113799390
Sequence CCACCCCACTGGAGTAAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113901246_1113901251 7 Left 1113901246 13:113799368-113799390 CCAGTTTTACTCCAGTGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1113901251 13:113799398-113799420 GTACGATGTCTACCAGACAGAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1113901246_1113901252 15 Left 1113901246 13:113799368-113799390 CCAGTTTTACTCCAGTGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1113901252 13:113799406-113799428 TCTACCAGACAGAGGTGAGCAGG 0: 1
1: 0
2: 3
3: 16
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113901246 Original CRISPR CCACCCCACTGGAGTAAAAC TGG (reversed) Exonic
900330332 1:2131057-2131079 CCACCCCACTGCAGTCCAGCTGG - Intronic
900880978 1:5381122-5381144 TCACCCCACTGGTGCAAAGCAGG - Intergenic
904933760 1:34111756-34111778 CCACCTCACTGGTATGAAACAGG + Intronic
906157217 1:43620767-43620789 CCACCCCTCTGGACTAGACCAGG - Intronic
906431005 1:45755812-45755834 CCACAACACTTGAGTAAAAAAGG - Intergenic
907144403 1:52219400-52219422 CCACCACACTGGGCTAAAAGGGG - Intronic
908768427 1:67574333-67574355 CAGCACCACTGGAGTAAAAATGG - Intergenic
909981153 1:82102899-82102921 TGACCCCAATGGAATAAAACTGG - Intergenic
916680091 1:167095906-167095928 CTTCCCCAGTGGAGTAAGACAGG + Intronic
1068700095 10:60010433-60010455 CCACCCCACCCAAGAAAAACAGG + Intergenic
1071252805 10:83838184-83838206 CCACCCTACTGCAATAAAATAGG + Intergenic
1072289628 10:93952234-93952256 CCACTCCACTGGATGAAAGCAGG - Intronic
1073024763 10:100479879-100479901 CCACACTGCTGGAGTAAATCAGG - Exonic
1073439274 10:103543160-103543182 CCACCCCACTGCAGGACTACAGG - Intronic
1073572504 10:104592414-104592436 AGACCCCACTGGAGAAGAACAGG + Intergenic
1074832590 10:117259926-117259948 TCAGCCAACTGGAGTAAAACAGG - Intronic
1076085942 10:127631935-127631957 AGACCACACTGGAATAAAACTGG - Intergenic
1076350241 10:129810640-129810662 CCTCCCCACTGTAGAAGAACAGG + Intergenic
1076468713 10:130703843-130703865 ACGCCCCACAGGAGAAAAACGGG - Intergenic
1079246895 11:18759093-18759115 CCACTCCACTGCTGTAGAACTGG + Intronic
1079523768 11:21360323-21360345 AGACCCCAGTGGAATAAAACTGG - Intronic
1088609523 11:111563885-111563907 CCACCCCACAGAAGTGAATCCGG + Intergenic
1088922178 11:114268144-114268166 CCACTCCACTGGCCTAAAGCTGG - Intronic
1089609243 11:119660381-119660403 CCAGCCCCCTGGAGAAAAATGGG + Intronic
1095841902 12:46702422-46702444 CTACTCCTCTGTAGTAAAACTGG + Intergenic
1097069305 12:56343239-56343261 TCACCCCAATGGAGTCACACAGG + Exonic
1097423249 12:59408374-59408396 CCCTCCCACTGAAGTCAAACAGG + Intergenic
1102245484 12:111353202-111353224 CCACTGCCCTGGAGTGAAACAGG + Intergenic
1103996875 12:124835856-124835878 CCAGCCCGCTGGAGCAAAGCAGG + Intronic
1105378552 13:19865059-19865081 CCATACCACAGAAGTAAAACGGG - Intergenic
1106574650 13:30963242-30963264 CTTTTCCACTGGAGTAAAACTGG - Intronic
1106944636 13:34813428-34813450 GAACCCCACAGGAGTAAACCTGG + Intergenic
1109186388 13:59273723-59273745 CCAAGCCAGAGGAGTAAAACTGG + Intergenic
1109213349 13:59560710-59560732 TCAGGCCACTGGAATAAAACTGG - Intergenic
1111429988 13:88136979-88137001 CCACCCCACTGGAGAATAAAGGG - Intergenic
1113148102 13:107231212-107231234 TTACCCCACTGGAGTAAAGATGG + Intronic
1113901246 13:113799368-113799390 CCACCCCACTGGAGTAAAACTGG - Exonic
1115825970 14:37276473-37276495 ACACCCCAGTGGATTAAAATGGG + Intronic
1115958919 14:38812556-38812578 ACACCACAGTGGAATAAAACTGG + Intergenic
1116317972 14:43421909-43421931 CCACCCAACTTGAGTAGGACAGG - Intergenic
1122664469 14:103319095-103319117 CCATCCCACTGCTGAAAAACAGG + Intergenic
1131574751 15:93576989-93577011 CTACACCACTGGAGAAACACTGG - Intergenic
1132315426 15:100886773-100886795 CCACCCCATGGGAGCAGAACTGG - Intronic
1132562497 16:603347-603369 CAACCCCACTGCAGGCAAACCGG - Intronic
1134656431 16:15950989-15951011 CAACCCCACTGGCTTAAAATGGG - Intronic
1142063419 16:88045891-88045913 CCACCCCACTGCAGTGAAGAGGG - Intronic
1143961640 17:10726111-10726133 CCAACTCCCAGGAGTAAAACGGG - Intronic
1145745445 17:27316071-27316093 CCACCCACCTGTAATAAAACAGG - Intergenic
1148715911 17:49715726-49715748 CAGCCCCACTGGAGTAGAATGGG - Intronic
1150160701 17:62895518-62895540 CCACCCCACTGGGGTGAAAATGG - Intergenic
1152747155 17:82046365-82046387 CCACCCCTCTGGAGGAAACAGGG - Intergenic
1153443872 18:5150917-5150939 CCGCCTCACTGGAATATAACAGG - Intronic
1160008408 18:75085679-75085701 CTACCCGCATGGAGTAAAACGGG + Intergenic
1162448297 19:10738018-10738040 CCACCCTTCTGGAGTCAAACAGG + Intronic
925334140 2:3080598-3080620 CCACCCCACTGGAGTCAATGCGG + Intergenic
925567456 2:5271673-5271695 GCTCCCCACTGGAGGAAAAAAGG - Intergenic
926371669 2:12184943-12184965 CCACTCCACTGCAGTCAAATTGG - Intergenic
927522558 2:23708474-23708496 CTATCACACTGGAGCAAAACTGG + Exonic
930154295 2:48090190-48090212 CCTCCCCACAGGAGTAAGAAGGG + Intergenic
933600980 2:84329820-84329842 CCAGGCCCCTGGAGTAAAACTGG + Intergenic
937781736 2:125846516-125846538 ACACCACAGTGGAATAAAACTGG - Intergenic
938261488 2:129898788-129898810 TCACCACAGTGGAATAAAACTGG + Intergenic
938707149 2:133942237-133942259 CAACCCCAATGGAGCATAACAGG + Intergenic
945250716 2:207764389-207764411 CCACCCCAGGGGAGAGAAACTGG - Exonic
945825986 2:214720415-214720437 AGACCACACTGGAATAAAACTGG + Intergenic
948771830 2:240255178-240255200 CTCCCCCACTGCAGTAAAAGAGG + Intergenic
1172808625 20:37631605-37631627 CCACTCCCCTTGAGTAAATCTGG + Intergenic
1172995261 20:39065626-39065648 CCACCTCACGGGAGTAGAGCTGG + Intergenic
1173310527 20:41892657-41892679 CCATCCCACTGGAGTCAACAGGG + Intergenic
1173458614 20:43223948-43223970 CCACCCCGCTGGAGGGAAACTGG - Intergenic
1173458848 20:43225593-43225615 CCACCCCGCTGGAAAGAAACTGG + Intergenic
1174589644 20:51635025-51635047 CCACCCCCCTGGAGTGGAGCTGG + Intronic
1180040111 21:45272709-45272731 AGACCACAGTGGAGTAAAACTGG + Intronic
1181717404 22:24741694-24741716 AGACCACAGTGGAGTAAAACTGG + Intronic
1184409550 22:44318603-44318625 TCACACCACCGAAGTAAAACTGG - Intergenic
949124666 3:432896-432918 CCACCCACCTGGAGGACAACCGG + Intergenic
949321799 3:2819774-2819796 CCACCCCACTGCAGTGTACCTGG + Intronic
951520959 3:23610300-23610322 TCGCCCCACTAGAGTAAAACAGG + Intergenic
959954945 3:112226198-112226220 TGACCACAATGGAGTAAAACTGG + Intronic
960707348 3:120493813-120493835 CCACCACACTCGAGTAAAAAGGG + Intergenic
962037833 3:131671628-131671650 CCTCCCCATTAGAGTAAAAGGGG + Intronic
962104821 3:132379702-132379724 CATCCCCACTGGAGTAAATAGGG - Intergenic
963877037 3:150487790-150487812 CAACCACAATGGAATAAAACTGG + Intergenic
965027693 3:163324415-163324437 CCAACCCCCTGGAGTGATACGGG - Intergenic
965216634 3:165872514-165872536 ACACCACAGTGGAATAAAACTGG - Intergenic
967742706 3:193020959-193020981 CCACCACAGTGGAGTGGAACTGG - Intergenic
968018442 3:195361031-195361053 CGACCACAATGGAATAAAACTGG + Intronic
972013150 4:34209439-34209461 CTGCACCCCTGGAGTAAAACAGG + Intergenic
976215236 4:82709925-82709947 CTACCTCATAGGAGTAAAACAGG - Intronic
978378622 4:108102709-108102731 CCAGACCACTGGAATAAGACAGG - Intronic
979567927 4:122177632-122177654 CCACCCCACTCCAGATAAACTGG + Intronic
982048169 4:151470427-151470449 TGACCCCACTGAAGTAAAAGAGG - Intronic
982828007 4:160024302-160024324 TGACCACAATGGAGTAAAACTGG - Intergenic
990233574 5:53741655-53741677 ACACCACAGTGGAATAAAACTGG + Intergenic
990339108 5:54804860-54804882 CCACCCCTATTGAGAAAAACTGG + Intergenic
996103202 5:119466558-119466580 CCAACAAACTGGAGGAAAACTGG - Intronic
1003063391 6:2880099-2880121 ACACCACAGTGGAATAAAACTGG + Intergenic
1003543991 6:7042967-7042989 CCATCCCACTGAAGCAAAAAAGG + Intergenic
1005575264 6:27184126-27184148 CCACCACACTTGAGTGAAAAAGG + Intergenic
1007500797 6:42295276-42295298 CCACCTCACTTCTGTAAAACAGG - Intronic
1008305553 6:49894708-49894730 AGACCACAGTGGAGTAAAACTGG + Intergenic
1009783763 6:68303793-68303815 TTACCACAATGGAGTAAAACTGG + Intergenic
1010333633 6:74654872-74654894 TCCCCACACTGGAGTAAAGCTGG - Intergenic
1011168872 6:84481796-84481818 ACACCACAGTGGAATAAAACTGG + Intergenic
1013842361 6:114412664-114412686 CCACACTGCTGGAGTAAAATTGG + Intergenic
1014666551 6:124244630-124244652 CCACTCCACTAAAGTAAATCAGG + Intronic
1015290479 6:131532822-131532844 CCACTCCACTGGTGTAAGACAGG - Intergenic
1017285122 6:152665693-152665715 CAACCACAATGGAATAAAACTGG - Intergenic
1020635140 7:10687361-10687383 AGACCACAGTGGAGTAAAACTGG + Intergenic
1026284745 7:68953430-68953452 CCATCCTACTGGTGTACAACTGG + Intergenic
1029629590 7:101742258-101742280 CCACCCCACTTGCCTAAGACAGG - Intergenic
1030079854 7:105767872-105767894 CCACCCCTCTGGAGTTCGACTGG + Intronic
1030611593 7:111695646-111695668 CCATCCCAGTGGAGTTAAAATGG + Intergenic
1031087935 7:117322363-117322385 CCGCCCCACTGGGGTGAACCTGG + Intronic
1031139105 7:117921684-117921706 ACACCACAGTGGAATAAAACTGG + Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032935865 7:136730781-136730803 ACACCACAGTGGAGTAAAATTGG + Intergenic
1033141190 7:138828209-138828231 CCAGACCACTGCAGTAAAGCAGG - Intronic
1041228011 8:55719529-55719551 AGACCACACTGGAATAAAACTGG + Intronic
1042413471 8:68491941-68491963 CCACCCTACTGGAGGGAAACTGG - Intronic
1044741513 8:95332233-95332255 CCACCCCACTGCAGGAGAATGGG - Intergenic
1048525219 8:135196404-135196426 TCACACCACTGCAGTCAAACTGG - Intergenic
1055427082 9:76207335-76207357 CCACTTCACTGAAGTAAAAATGG - Intronic
1056136074 9:83630463-83630485 CTACCCCACAGGAGAAAAATGGG - Intronic
1058322785 9:103655342-103655364 CAACCACAATGGAATAAAACTGG + Intergenic
1058540465 9:106006959-106006981 AGACCACAGTGGAGTAAAACTGG - Intergenic
1058803513 9:108567612-108567634 CCACTCCACTGGATAAAAATTGG - Intergenic
1059456352 9:114402598-114402620 CCAGCCCACTGGACCAGAACTGG - Exonic
1185615519 X:1419446-1419468 ACACCTCACTGGAGAAAACCAGG + Intronic
1194955795 X:100178880-100178902 AGACCACACTGGAATAAAACTGG + Intergenic
1196074150 X:111556301-111556323 ACACAGCACTGGAGTAAAAGAGG + Intergenic
1197602335 X:128544979-128545001 TCACCACAATGGAATAAAACTGG - Intergenic
1198546510 X:137697935-137697957 CAGCCCCAGTGGACTAAAACAGG + Intergenic
1199553233 X:149079392-149079414 CCACCACACTGGCGAAAACCAGG - Intergenic
1199564558 X:149200749-149200771 AGACCACAGTGGAGTAAAACTGG - Intergenic
1202043863 Y:20716743-20716765 AGACCACACTGGAATAAAACTGG + Intergenic