ID: 1113904444

View in Genome Browser
Species Human (GRCh38)
Location 13:113812779-113812801
Sequence GACCTGTCCTGTGACCCACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 151}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113904444_1113904454 18 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904454 13:113812820-113812842 CTGAGTGGGTCACAGGTCCCGGG 0: 1
1: 0
2: 4
3: 27
4: 230
1113904444_1113904453 17 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904453 13:113812819-113812841 CCTGAGTGGGTCACAGGTCCCGG 0: 1
1: 0
2: 3
3: 22
4: 182
1113904444_1113904450 4 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904450 13:113812806-113812828 GTGGGTCACAGGTCCTGAGTGGG 0: 1
1: 1
2: 5
3: 16
4: 188
1113904444_1113904451 11 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904451 13:113812813-113812835 ACAGGTCCTGAGTGGGTCACAGG 0: 1
1: 1
2: 2
3: 24
4: 181
1113904444_1113904448 -7 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904448 13:113812795-113812817 ACAGGTCTCAGGTGGGTCACAGG 0: 1
1: 0
2: 1
3: 28
4: 190
1113904444_1113904455 21 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904455 13:113812823-113812845 AGTGGGTCACAGGTCCCGGGTGG 0: 1
1: 1
2: 4
3: 14
4: 124
1113904444_1113904449 3 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904449 13:113812805-113812827 GGTGGGTCACAGGTCCTGAGTGG 0: 1
1: 1
2: 3
3: 21
4: 245
1113904444_1113904457 29 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904457 13:113812831-113812853 ACAGGTCCCGGGTGGGTCACAGG 0: 1
1: 7
2: 6
3: 4
4: 137
1113904444_1113904456 22 Left 1113904444 13:113812779-113812801 CCGGGTGGGTCACAGGACAGGTC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1113904456 13:113812824-113812846 GTGGGTCACAGGTCCCGGGTGGG 0: 1
1: 5
2: 5
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113904444 Original CRISPR GACCTGTCCTGTGACCCACC CGG (reversed) Exonic
900146850 1:1162302-1162324 GACCGATCCTGAGACCCACCTGG + Intergenic
901323150 1:8351439-8351461 GACCTGGACTGAGAGCCACCTGG + Intergenic
903355832 1:22746856-22746878 CTCCTGACCTGTGACCCCCCGGG + Intronic
904456895 1:30653318-30653340 GACCTGTCCTGACACTCAACTGG - Intergenic
904964402 1:34360505-34360527 GGCCTCCTCTGTGACCCACCAGG - Intergenic
905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG + Exonic
908785877 1:67734119-67734141 TAGCTGTCCTGTGTCCCAGCGGG + Intronic
910592137 1:88937231-88937253 GACCTGTCCTGTCATCCTCCTGG - Intronic
911348448 1:96723387-96723409 TACCTGTACTGTTACCAACCTGG - Intronic
914955083 1:152154904-152154926 CGCCTGTCCTGTGTCCCACATGG + Exonic
915340189 1:155173110-155173132 GACGTGTCCTGGGTTCCACCGGG - Intronic
915635227 1:157181654-157181676 GACCTGTCCTGAGTCACACAGGG - Intergenic
915666372 1:157448917-157448939 GACCTGGCCTGCCACACACCTGG + Intergenic
916245338 1:162682085-162682107 GGCCTGTCCTGTGTCCTGCCCGG + Intronic
919794526 1:201313331-201313353 GACCTCTACTGTGACCCACGGGG + Exonic
920700923 1:208217664-208217686 GCCCTGTCTTATGAGCCACCTGG + Exonic
920761099 1:208784350-208784372 GCCGTGTCCTGTGGCCCACTGGG - Intergenic
923227843 1:231955807-231955829 CACCTGGCATTTGACCCACCAGG + Intronic
924685805 1:246288464-246288486 GAGCTTTCCTGTGACCCAGTGGG + Intronic
1063353004 10:5373762-5373784 GGCCTGTCCTGGGGCCCCCCAGG - Exonic
1065127187 10:22584941-22584963 GAGCTGCCCTGTCACTCACCGGG + Intronic
1066701933 10:38139100-38139122 GACCTGTCTTGTGAACAACTGGG + Intergenic
1071579061 10:86754029-86754051 TACCTCTCTTGTGACCTACCTGG + Intergenic
1073311994 10:102549553-102549575 TACATGTCCTGTGAGCCACAAGG - Intronic
1074864578 10:117537352-117537374 GGCCTGTTCTCTGAACCACCTGG + Intergenic
1075807290 10:125198918-125198940 CACCTACCCTGTGACCCACATGG - Intergenic
1079979264 11:27131991-27132013 CTCCAGTCTTGTGACCCACCAGG + Intergenic
1080646951 11:34194375-34194397 GCCCCGTCCTCTGTCCCACCTGG - Intronic
1083688307 11:64391010-64391032 GGGCTGTCCTGTGGCCCACAGGG + Intergenic
1084966935 11:72749938-72749960 AACCTGTCCTGACCCCCACCAGG + Intronic
1088693285 11:112345798-112345820 GATCTGCCTTGTGACCCAGCTGG - Intergenic
1089731878 11:120524447-120524469 AACCAGTCCTGTCATCCACCAGG - Intronic
1094475375 12:30836741-30836763 ATCCAGACCTGTGACCCACCAGG + Intergenic
1106785219 13:33100682-33100704 GTCCTGTCCTTTGACTCCCCTGG + Intergenic
1113313340 13:109153960-109153982 CACCTGCCCTGTGGCCCATCAGG + Intronic
1113386291 13:109851359-109851381 GTCCGGTCCTGTGCCCCTCCTGG - Intergenic
1113904444 13:113812779-113812801 GACCTGTCCTGTGACCCACCCGG - Exonic
1122720701 14:103720692-103720714 GAGCTGCCCTGTGACCCTCGAGG + Intronic
1122886014 14:104710787-104710809 GCCCTGTCCTGTGATCCTTCCGG + Intronic
1123118444 14:105905307-105905329 AACCTGTCCTGGAACTCACCTGG - Intergenic
1124254626 15:28130810-28130832 GCCCTGTGCTGGGTCCCACCGGG - Intronic
1125433655 15:39624033-39624055 AACCTGGCCAGTGACCAACCAGG - Intronic
1126047530 15:44656514-44656536 CACCTGTCCTCTGACCTAACTGG - Intronic
1134111689 16:11518998-11519020 GACCTCTCCTGTGATACCCCGGG + Intronic
1134759090 16:16697729-16697751 GACCAGTCCTGTGGCCCATGTGG - Intergenic
1134986984 16:18661455-18661477 GACCAGTCCTGTGGCCCATGTGG + Intergenic
1135964114 16:27021773-27021795 GGCCAGTCCTGTGAAGCACCAGG - Intergenic
1138540119 16:57682751-57682773 TCCCTGTCCAGTGACTCACCAGG - Intronic
1138654228 16:58481627-58481649 CTCCTGTCCTGCCACCCACCCGG + Intronic
1139381849 16:66537404-66537426 GCCCTGTCCAGTGTCCCTCCTGG - Intronic
1141140476 16:81493864-81493886 GGCCTGCCCTGTGACTCACGCGG + Intronic
1143286136 17:5790641-5790663 GACCTGTGCTGTGCCCCAGGAGG + Intronic
1143703938 17:8683552-8683574 TCCCAGTCCTGTGACCCACAGGG + Intergenic
1149163449 17:53722771-53722793 CAACTGTCCTGTGACCATCCAGG - Intergenic
1151932665 17:77242294-77242316 GACCAGCCCTGTGCCCTACCAGG - Intergenic
1157293390 18:46425391-46425413 TACCTGGCCTGCCACCCACCCGG - Intronic
1157578445 18:48759194-48759216 GACCTTTCCTGTGCCCCTGCTGG - Intronic
1161367023 19:3885895-3885917 GGCCGCTCCTGTGTCCCACCTGG - Intronic
1161397715 19:4053238-4053260 GGCCTGTGCTGTCACCCACCGGG + Intronic
1162561597 19:11420813-11420835 GACTCGTCCTGACACCCACCAGG - Exonic
1164540378 19:29117551-29117573 CACCAGTCCAGTGCCCCACCAGG - Intergenic
1165006093 19:32808415-32808437 GACCTGGCCTGTGGCTCGCCTGG + Intronic
1165725593 19:38110442-38110464 GCCCTGTACTGGGACCCACTTGG - Intronic
1168513616 19:56993077-56993099 CACATGTCCTGTGCCTCACCTGG - Intergenic
924993944 2:340327-340349 CACCTGTGCTGTGACCCCCTTGG - Intergenic
925054421 2:846202-846224 GACCTGTGGTCTGAACCACCAGG - Intergenic
925192703 2:1898574-1898596 GACCCGGCCTGTGACCTAGCAGG + Intronic
927801044 2:26099968-26099990 GTCCTGTCCTGGGTCCTACCCGG + Intronic
928103616 2:28453552-28453574 TCCCTGTGCTGGGACCCACCTGG - Intergenic
928146053 2:28776594-28776616 TTGCTGTCCTGTGACCAACCTGG - Intronic
928363487 2:30684263-30684285 GACCTGTCCTGTCATTCAGCTGG - Intergenic
931753809 2:65353996-65354018 GCTGTGTCCTGTGACCCACAAGG + Intronic
932235983 2:70121476-70121498 GTCCTCTCCTGTGGCCCACATGG + Intergenic
933216926 2:79641602-79641624 GAGGTGTCCAGTGTCCCACCAGG - Intronic
937362784 2:121240620-121240642 GACCTGGCATGTGGCTCACCAGG + Intronic
938252672 2:129827719-129827741 GGCCTGGCCTCTGACCCAGCAGG - Intergenic
941014839 2:160343591-160343613 GACCTCTGCTGTGAGTCACCTGG + Intronic
944408753 2:199415782-199415804 CACCTGCACTGTGACCCTCCTGG + Intronic
944499734 2:200347159-200347181 GACCTCTTCTGTGGCCCACTTGG - Intronic
945187731 2:207156647-207156669 CACATTTCCTGTGACCCATCAGG - Intronic
945648254 2:212528331-212528353 GCCCTGTCCTGAGAGCCAGCTGG - Intronic
946220456 2:218221506-218221528 CACCTGTCCTGTGGCCTACTTGG + Intronic
947588845 2:231373121-231373143 GTCCTGACCTGTCAGCCACCAGG + Intronic
1169144108 20:3241189-3241211 CTCCTGTCCTGTGCCCCACTGGG + Intergenic
1171421951 20:25023507-25023529 TGTCTGTCCTGTGAGCCACCAGG + Exonic
1172093888 20:32451389-32451411 AAGAGGTCCTGTGACCCACCAGG + Intronic
1173706418 20:45113631-45113653 GACCTGTCCTGTTGCCTTCCAGG + Intronic
1175821342 20:61910776-61910798 GACCTGTCATGTGACCTTCAGGG + Intronic
1175897868 20:62347331-62347353 GCCCTGTCCTAGGCCCCACCCGG - Intronic
1178407409 21:32335922-32335944 GCCCTGTCCTGTGACTCCCTGGG + Intronic
1179076832 21:38130180-38130202 GAACTGTTCTGAGACCCACTAGG - Intronic
1179600034 21:42471378-42471400 CACCTGTCCTGTGGCCGCCCAGG - Intergenic
1179914500 21:44467556-44467578 GAGCTGTTCTGGGGCCCACCTGG - Intergenic
1180130934 21:45826712-45826734 GACTTGTCCAGTGCCCCATCTGG - Intronic
1180852411 22:19028240-19028262 GCTCTGTCCTGGGGCCCACCCGG + Intergenic
1180921029 22:19521754-19521776 GGCCTGACCTGTACCCCACCTGG - Intergenic
1182258382 22:29054489-29054511 GACCTGAACTCTGACCCTCCGGG + Exonic
1182621555 22:31621315-31621337 CGCCTGTGCAGTGACCCACCTGG + Exonic
1183058860 22:35323174-35323196 GCCCTGTCCTGGCACTCACCTGG - Exonic
1183695012 22:39416769-39416791 GCCCTGTCCTGTGTCCCCCTAGG + Exonic
1184164475 22:42719775-42719797 GACCTGGCCTGAGACCCACCAGG + Intronic
1185111976 22:48905266-48905288 GGCTTCTCCTGTGCCCCACCAGG - Intergenic
950672362 3:14534978-14535000 GCCCTGTTCTGTGAGCCTCCTGG + Intronic
954749832 3:52807198-52807220 GATCTTTCCTGTGACCCCCATGG - Intronic
957732044 3:84151406-84151428 AACCTGTCCAGGGACCCAACAGG - Intergenic
960996435 3:123343554-123343576 TACCTTTGCTGTGACCCACGTGG + Intronic
972186333 4:36532803-36532825 GACCTGTCCTGGGGCACAACAGG - Intergenic
974034532 4:56806023-56806045 GACCTGCCCTGTTTCCAACCTGG - Intergenic
980573224 4:134650873-134650895 GAACTGTCCTCTTACCCTCCTGG + Intergenic
985591401 5:767213-767235 GACCTGGCCTGTGGCAGACCTGG + Intergenic
986216849 5:5727265-5727287 GCTCTGTCCTGTCAACCACCTGG + Intergenic
986290790 5:6397232-6397254 GACCTGCCCTGTGGCCTGCCCGG - Intergenic
987092823 5:14522885-14522907 GTCCTGTCCTTTCATCCACCTGG + Intronic
987419149 5:17697968-17697990 GAGAAGTCCTCTGACCCACCTGG - Intergenic
991947744 5:71916217-71916239 GACCTGCCCTCAGGCCCACCTGG - Intergenic
992331731 5:75723813-75723835 GACCTGTATTGTGAGCCACTTGG - Intergenic
995285807 5:110386912-110386934 GATCTGTGGAGTGACCCACCAGG - Intronic
996746102 5:126847440-126847462 GACTTATCTTGTGACCCACTTGG + Intergenic
999149065 5:149414792-149414814 AAGCTTTCCTGTGACCCTCCTGG - Intergenic
1001118895 5:168962597-168962619 GACCTTTCCTTTGGCCAACCAGG - Intronic
1001979524 5:176029577-176029599 GTCCTGGCCTGTGACAGACCAGG + Intronic
1002237893 5:177814186-177814208 GTCCTGGCCTGTGACAGACCAGG - Intergenic
1002275748 5:178103507-178103529 GTCCTGGCCTGTGACAGACCGGG + Intergenic
1002487625 5:179550543-179550565 GCCGTGTCATGTGACCCAGCGGG - Exonic
1003194218 6:3900711-3900733 CACCTGTACTGTCCCCCACCTGG - Intergenic
1004796233 6:19088609-19088631 CACCTGTGCTGTGACCACCCAGG + Intergenic
1006395338 6:33783453-33783475 GACCTGTCCTCTGACCCCACAGG + Intronic
1008700491 6:54093742-54093764 TACTGGCCCTGTGACCCACCAGG + Intronic
1010503993 6:76633804-76633826 GAGCTCTCCTCTGACCTACCTGG + Intergenic
1013052523 6:106549988-106550010 TACCTGTCCTGAGGCCCACCAGG - Intronic
1019745023 7:2695016-2695038 CACCTGCCCTGGGACCCGCCTGG + Intronic
1023362612 7:39431861-39431883 GACCTGGCCTGGGGGCCACCAGG - Intronic
1023650047 7:42359884-42359906 TACCTCCCCTGTGACCCACTTGG + Intergenic
1023966194 7:44964192-44964214 GTGCTGCCCTGTCACCCACCAGG + Intronic
1026121483 7:67541810-67541832 GACCTATGCTGTCACACACCAGG + Intergenic
1029117187 7:98243391-98243413 GTCCTGTCCTGTGCACCCCCTGG - Intronic
1029620034 7:101684639-101684661 GCCCTGACCTGTGCCCCACTTGG - Intergenic
1035074744 7:156169977-156169999 GAGCCGTCCTGGGACCCGCCAGG + Intergenic
1037914856 8:22766829-22766851 GGCCTGTGCTGTGACCCACCTGG - Intronic
1040575576 8:48648380-48648402 GACCTCTCCTGAGCCACACCTGG + Intergenic
1041804471 8:61834931-61834953 GACCAGGCTTGGGACCCACCGGG + Intergenic
1047199896 8:122756149-122756171 CACCTGTAATGTGACCCACGTGG - Intergenic
1049069325 8:140344839-140344861 TACGTGTCCTGGGAGCCACCAGG + Intronic
1049289954 8:141796568-141796590 GACCTGTACCAAGACCCACCGGG - Intergenic
1049367493 8:142247672-142247694 GACCTGCTCTGTTTCCCACCTGG + Intronic
1051225938 9:14899208-14899230 GACATGGCCTGTGAGCCACCAGG - Intronic
1056896875 9:90559347-90559369 GACCTGGCCTGCATCCCACCAGG + Intergenic
1057833462 9:98425624-98425646 CACCAGGCCTGTGGCCCACCTGG - Intronic
1060491083 9:124084815-124084837 CACCTCCCCTGTGACCCTCCTGG - Intergenic
1061492329 9:130952593-130952615 GTCCTGTTCTGTGTCCCAGCAGG + Intergenic
1062370650 9:136237028-136237050 AGCCTGTCCTGTGCCACACCTGG + Intronic
1062370700 9:136237224-136237246 AGCCTGTCCTGTGCCACACCTGG + Intronic
1062370733 9:136237351-136237373 AGCCTGTCCTGTGCCACACCTGG + Intronic
1186416343 X:9386166-9386188 GACCTGTTCTGTCAAGCACCAGG - Intergenic
1187774460 X:22740210-22740232 GAACTGTCCTATGACCCCTCTGG + Intergenic
1189186169 X:39057281-39057303 GTCATGTTCTGTGCCCCACCTGG + Intergenic
1192534494 X:71915692-71915714 GACCTGCTGTGTGACCCAGCCGG - Intergenic
1193635944 X:83948983-83949005 GACTTGTCCTCAGACCCACTGGG + Intergenic
1193953958 X:87835550-87835572 GACTTGTCCTCAGACCCCCCTGG + Intergenic
1199364983 X:146970915-146970937 CACTTGTCCTGTGAACCATCTGG + Intergenic
1199382388 X:147184855-147184877 CACTTGTCCTGTGAACCATCTGG - Intergenic
1201303553 Y:12531380-12531402 GAGCTGCTCTGTGCCCCACCAGG - Intergenic