ID: 1113905182

View in Genome Browser
Species Human (GRCh38)
Location 13:113816069-113816091
Sequence CAGTCACTGCTCAGGGACAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 2, 1: 0, 2: 5, 3: 20, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113905182 Original CRISPR CAGTCACTGCTCAGGGACAC GGG Exonic
900463082 1:2810625-2810647 CAGGCCCTGCACAGGGGCACAGG - Intergenic
901367470 1:8765361-8765383 GAGTAACTGCTCATGGATACAGG + Intronic
902674957 1:18002272-18002294 TGGTCATGGCTCAGGGACACAGG + Intergenic
902727582 1:18347339-18347361 CACTCACTGCTGTGGGACAGTGG - Intronic
902837193 1:19054689-19054711 CAGTCCCTCCTCATGGGCACTGG - Intergenic
904916445 1:33973745-33973767 CTGTCCCTGCTCAGGCACCCTGG - Intronic
905257995 1:36697519-36697541 CAGTCACCACGAAGGGACACAGG - Intergenic
905488053 1:38320835-38320857 TGGTCACAGTTCAGGGACACAGG - Intergenic
905941673 1:41867982-41868004 CTTTCACTGCTCAGAGACATTGG - Intronic
906814525 1:48865378-48865400 CACTCAGCTCTCAGGGACACAGG - Intronic
907094127 1:51760219-51760241 CAGTCACTCCTCAGGTATCCAGG - Intronic
908184819 1:61642446-61642468 CAATCACTGCTCTGGCACATCGG - Intergenic
910775854 1:90873849-90873871 CATTTACTGCAAAGGGACACAGG - Intergenic
911455747 1:98121127-98121149 CAGAGACTGTTCAGTGACACTGG + Intergenic
912379366 1:109239070-109239092 AAGTCGCTGCTCAGGGACTAAGG - Intergenic
913008352 1:114657143-114657165 CAGTCACTCCTCAGTCATACTGG + Intronic
915563239 1:156699892-156699914 CAGTCACTTCTGGGGGTCACTGG - Exonic
916070249 1:161165870-161165892 CCTTCACTGCTGGGGGACACAGG - Intergenic
916500379 1:165381974-165381996 AAATGACTGCTCAGGGACCCAGG + Intergenic
916862982 1:168826171-168826193 CAGTCACTTCTCAGATACAAGGG - Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
919807110 1:201386632-201386654 CAGCGACTTCTCAGAGACACTGG + Exonic
920500673 1:206483068-206483090 CAGGCACTGCTCAGGCAGCCAGG + Intronic
920506430 1:206518434-206518456 CAGTCACTGCTCAGCTCCAGCGG + Intronic
921132165 1:212229236-212229258 GCGTCACTGTTCAGGGACATTGG + Intergenic
923732371 1:236564856-236564878 CACTCGCTTCTCAGGGCCACTGG - Intronic
1062919825 10:1271364-1271386 CAGTCACTGCTCTGAGAGGCAGG - Intronic
1063484162 10:6403483-6403505 AACTCACGGTTCAGGGACACTGG - Intergenic
1064337067 10:14453337-14453359 CAGTGACTGTTCAGGGAAATGGG + Intronic
1066250656 10:33629788-33629810 CTGTCAGTGCTCTGGGACAGCGG - Intergenic
1066568684 10:36748420-36748442 CCCTCACTGCTCAGGGCCAGTGG - Intergenic
1066998871 10:42587715-42587737 CAGGCCATGCTCAGGCACACTGG + Intronic
1067077501 10:43196575-43196597 CAGACACTGCATGGGGACACAGG - Intronic
1067294000 10:44964127-44964149 CTGTCACTACTGAGGGACAAAGG - Intronic
1068041326 10:51828405-51828427 CAGTCTTTGCTCAGTAACACAGG - Intronic
1069708703 10:70475528-70475550 CTGCCACAGCTGAGGGACACTGG - Intergenic
1070072831 10:73105925-73105947 GAGTAACTGCTCATGGAAACAGG - Intergenic
1074057783 10:109938378-109938400 CAGGCACTGCTCCGGGGCACTGG - Intergenic
1075545936 10:123354721-123354743 GAGTCATTGCTCAGGGCTACAGG + Intergenic
1075810725 10:125222793-125222815 CAGCCTCTGCTCAGGGTCTCAGG - Intergenic
1075865365 10:125714196-125714218 CAGTCAGTCCTAAGGGTCACTGG + Intergenic
1075995756 10:126874807-126874829 CAGTCACTGCTCCGAGCCATGGG - Intergenic
1076657006 10:132031393-132031415 CTCTGAATGCTCAGGGACACAGG + Intergenic
1076855699 10:133114772-133114794 CCTTCACTGCCCTGGGACACGGG - Intronic
1077149982 11:1068238-1068260 CATTCCCTGCTAATGGACACTGG - Intergenic
1080122116 11:28690184-28690206 CAGTAAATGCCCAGGTACACAGG - Intergenic
1080648095 11:34201832-34201854 CAGCCACTCCTCAGGGCCAAAGG - Intronic
1081910704 11:46698029-46698051 CTGTCACTGCCCAGGGACCAGGG + Intronic
1084526185 11:69699467-69699489 TTGGCACTGCTCAGGGAGACCGG + Exonic
1086348084 11:85918328-85918350 CACAGACTGATCAGGGACACAGG - Intronic
1088723906 11:112618049-112618071 CAGTGGCTGCTGATGGACACAGG + Intergenic
1089279870 11:117366330-117366352 AAGTGACTGCTCAGTGAGACAGG - Intronic
1090077972 11:123591342-123591364 GAGTCAGTGCTCAGGGAGCCAGG + Intronic
1090630870 11:128646162-128646184 CTGTCAGTGCTCATGGAAACAGG + Intergenic
1091228083 11:133970094-133970116 CAGTCACTGGCCAGGGACGGAGG + Intergenic
1092117811 12:6021905-6021927 CTGGCAGTGCTCAGGGTCACTGG + Exonic
1092317520 12:7433635-7433657 CGGTCCCTGCTCTGGGACAGTGG - Exonic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1094361213 12:29633262-29633284 CAGTCATAGCACAGGGTCACGGG + Exonic
1094831608 12:34302803-34302825 CAGACACTGCGCAGGGCCTCGGG + Intergenic
1094835042 12:34318346-34318368 CAGTCCCTGCTTGGGGACCCGGG - Intergenic
1094836510 12:34324631-34324653 CAGCCACTGCGCAGGGCCCCGGG - Intergenic
1096448983 12:51721543-51721565 CAGTCACTGCTCAGCATCCCAGG + Exonic
1096569911 12:52516424-52516446 CAGCCAGTGCCCAGGAACACCGG + Intronic
1097929596 12:65169671-65169693 CCGTCACTGGTCCGGGAGACAGG - Exonic
1103722649 12:122982803-122982825 CAGTCTCTTCTCAGGGGCAGGGG + Exonic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1104366792 12:128185370-128185392 CTATCACTGCTCAGGGGAACAGG + Intergenic
1104751982 12:131245638-131245660 CAGCCAGGGCTCAGGGACATTGG + Intergenic
1106458628 13:29948948-29948970 CGGTGGCTGCTCAGGGACAGTGG + Intergenic
1107787082 13:43968445-43968467 CAGTCGCTGCTCCGGGCCTCCGG - Intergenic
1109316296 13:60753792-60753814 CAGTCATTCCTCAGGCAAACAGG - Intergenic
1109569809 13:64172925-64172947 TAGTTACATCTCAGGGACACAGG + Intergenic
1110790808 13:79584714-79584736 AGGTCACAGCCCAGGGACACAGG + Intergenic
1111504389 13:89167262-89167284 CTGACACTGATCAGGGAGACAGG + Intergenic
1111546103 13:89738543-89738565 GAGACACTTCACAGGGACACAGG + Intergenic
1111611513 13:90613796-90613818 CATTCTCTGGGCAGGGACACGGG + Intergenic
1112376951 13:98851529-98851551 CATTCACTGCTCTGGGCCCCAGG + Intronic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1115640528 14:35332936-35332958 CAGACCCTGCTCCGGGGCACAGG + Intergenic
1117994771 14:61468183-61468205 CAGCCACTGCTCAGGGAAAGGGG - Intronic
1119463072 14:74827802-74827824 CCCTGACTGCACAGGGACACAGG - Intronic
1121466093 14:94116339-94116361 CAGCCCCTGCTGAGGGTCACTGG + Intronic
1121872622 14:97423064-97423086 CTGGCACTCCTCAGGGTCACAGG + Intergenic
1122125179 14:99574965-99574987 CAGTGACTGGTCAAGGTCACAGG + Intronic
1122256672 14:100483129-100483151 CAGCCAGTGCTCTGGGACATGGG + Intronic
1122263206 14:100534840-100534862 GAGTCACTGGTCAGAGCCACAGG + Intergenic
1122440866 14:101730966-101730988 CAGTGATTGCTCAGGTACCCAGG + Intronic
1122455871 14:101850721-101850743 CAGACACTGCTCTAGGACACAGG + Intronic
1122742472 14:103880196-103880218 GAGTCAGTGCTCAGGGACACAGG - Intergenic
1122772363 14:104103105-104103127 CAGTCACTGCGCTGGGTTACAGG - Intronic
1123135895 14:106027070-106027092 CAGGCACTGATCAGGAACAGGGG + Intergenic
1123438674 15:20274030-20274052 CAGTCACTGCCCTGTGTCACTGG - Intergenic
1123483845 15:20665762-20665784 CAGTGAGGCCTCAGGGACACGGG + Intergenic
1123770946 15:23528043-23528065 CAGTCCCTGCTCAGGGTTTCTGG - Intergenic
1124346810 15:28928529-28928551 CAGTCACAGCCCAGGGAAATGGG - Intronic
1128562357 15:68677275-68677297 CAGTCTCTGCTCAGGCCCAGTGG - Intronic
1129117144 15:73370707-73370729 TAATCAGTGCTCAGGGTCACAGG - Intergenic
1129617105 15:77107255-77107277 CAGACAATCCCCAGGGACACAGG - Exonic
1130557877 15:84935564-84935586 CAGCCACTCCTCAGGGCCCCTGG + Intronic
1130828295 15:87572490-87572512 CAGCCTCTGCTACGGGACACTGG + Intergenic
1132289307 15:100688371-100688393 CAGTCATTGCTATGGGCCACAGG + Intergenic
1132605035 16:790091-790113 CCATCAGTGCTCAGGGACCCGGG - Intronic
1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG + Intergenic
1133226937 16:4345415-4345437 CAGTCACTACGCAGGGTCCCGGG + Intronic
1133327409 16:4950127-4950149 GAGTGACTGCTAAGGGGCACAGG + Intronic
1134896345 16:17890323-17890345 AAGTAACTGCTAATGGACACAGG - Intergenic
1135396750 16:22137553-22137575 AAGTCAATGCACAGAGACACTGG + Intronic
1136299499 16:29324282-29324304 CTGTAACTGCTCAGGCAGACAGG + Intergenic
1136556000 16:31008257-31008279 TAGTCACAGCTCAGGGAAACTGG - Intronic
1137301288 16:47150337-47150359 CACTCAATGCTCAGGGAATCGGG + Intergenic
1137308910 16:47233744-47233766 AGGTCACAGCCCAGGGACACAGG + Intronic
1137814631 16:51386749-51386771 CAGACATTGCCCAGAGACACTGG - Intergenic
1139128570 16:64112734-64112756 CTGTCACGGCCCAGGGAAACAGG - Intergenic
1141662186 16:85447296-85447318 CAGTGCCTTCTCAGGGCCACTGG - Intergenic
1141855072 16:86675387-86675409 CAGTCTCTGATCAGGGAAAGAGG - Intergenic
1142061245 16:88031111-88031133 CCGTAACTGCTCAGGCAGACAGG + Intronic
1143042870 17:4052234-4052256 AAGTGACTGCTCAGGGATACAGG + Intronic
1143390086 17:6555280-6555302 CAGTGCCTGCACAGGGAGACGGG + Intronic
1143878404 17:10011160-10011182 GAGTCTCTGCCTAGGGACACAGG + Intronic
1144087680 17:11825504-11825526 CAGTCTCTGCTCAAAGACCCAGG - Intronic
1144849654 17:18237635-18237657 CAGGCACTGCACCAGGACACGGG - Exonic
1146187654 17:30735868-30735890 CAGACACTGCGGAGGGCCACAGG - Intergenic
1154059111 18:11042302-11042324 CTGTCACAGCTCAGTCACACAGG + Intronic
1154389411 18:13923565-13923587 CAGCCACTGCTCAGTGACACAGG - Intergenic
1155931595 18:31714521-31714543 CAGTCCCTGCTTTGGGACTCTGG + Intergenic
1157297075 18:46453348-46453370 CACTCCCTGGTCCGGGACACAGG - Intronic
1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG + Intergenic
1157728484 18:49983776-49983798 CAGTCAGTTCTCTGGGAAACTGG - Intronic
1157997086 18:52571581-52571603 GAGTCAGGGCTCATGGACACTGG - Intronic
1160726265 19:619102-619124 CAGCCAGTGCTGTGGGACACAGG + Exonic
1163004148 19:14387066-14387088 CAGTAAATGCTCAGGCACACCGG + Intronic
1163618270 19:18342288-18342310 CAGTCCCTGCTCCTGGAAACTGG + Intronic
1164478993 19:28597235-28597257 CAGTCATTGCTCCTGGTCACAGG + Intergenic
1165003682 19:32787230-32787252 CAGCCTCTGCCCAGGGAAACAGG - Intronic
1202647878 1_KI270706v1_random:158078-158100 CAGTCCCTGCACTGGGACCCAGG + Intergenic
925064336 2:917310-917332 CTGTGTCTGCTCAGGGAGACTGG - Intergenic
926793939 2:16603418-16603440 CAGTGACAGATCAGGGTCACTGG + Intronic
927647666 2:24888256-24888278 CAGCCAGTGCACAGTGACACAGG - Intronic
928167627 2:28982280-28982302 CAGTCACTTCTCCAGGACAAGGG + Intronic
929835291 2:45390993-45391015 AAGTCACTGATCAGGGGCAGAGG + Intronic
930139907 2:47941163-47941185 GAGTCACTGCTAATGGACATGGG - Intergenic
934850117 2:97693663-97693685 CAGTCACTGCTCAGGAATCTTGG + Intergenic
935202015 2:100865479-100865501 CAGTCACCGGTCAGGGAACCAGG - Intronic
935619479 2:105116561-105116583 CAGGCACTGCACAGGGCCATGGG - Intergenic
936530418 2:113272554-113272576 CAGTCAGTGGTCAGTGACCCTGG - Intronic
936619750 2:114083042-114083064 CAGTCACTGCTCTGCAACGCGGG - Intergenic
937153429 2:119701558-119701580 TTGTCACTGCGCTGGGACACCGG - Intergenic
942068102 2:172291001-172291023 CAGTCCCTGCTCACAAACACAGG - Intergenic
942108411 2:172656401-172656423 AGGTCACAGCCCAGGGACACGGG - Intergenic
945216464 2:207439361-207439383 CAGGCACTGCTTTGGGACCCTGG - Intergenic
947299735 2:228675774-228675796 GATTCACTGCCAAGGGACACTGG - Intergenic
947521386 2:230848786-230848808 CAGTGACTTCTGATGGACACAGG + Intergenic
947709900 2:232307081-232307103 CAGGCACGGCACAGGGCCACGGG - Intronic
947743736 2:232497040-232497062 GAGCTACTGCTCAGGGTCACAGG + Intergenic
948607300 2:239144186-239144208 CAGACACTGCTCAGGGGCAGCGG + Intronic
948873400 2:240815217-240815239 CAGTCAATGCTCAAGGTCATGGG - Intronic
949001803 2:241619043-241619065 AGGTCACGGCTCAGGGACACGGG + Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1169394743 20:5219518-5219540 CAGCCACTGCTCTGGGCAACAGG - Intergenic
1169617284 20:7462806-7462828 CAGTCACTGCTCTGGAAGACAGG - Intergenic
1169945236 20:10981075-10981097 CAATCACTGTTCGGAGACACTGG - Intergenic
1170293749 20:14801242-14801264 CTGTCACTGCTGAGGGGCGCAGG - Intronic
1172108220 20:32529173-32529195 CAGTAAGTGCTCGGGGTCACAGG - Intronic
1172301635 20:33854624-33854646 CTGGCACTGCCCATGGACACTGG - Intergenic
1175792117 20:61746278-61746300 CAGTCATGTCTCAGGGACTCAGG - Intronic
1176100526 20:63362371-63362393 CAGTGGCTGCTCAGGGAAGCTGG - Intronic
1176603973 21:8814651-8814673 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1178193465 21:30314800-30314822 AGCTCACAGCTCAGGGACACAGG - Intergenic
1179156352 21:38854256-38854278 AGGTCACAGCCCAGGGACACAGG + Intergenic
1179612880 21:42563941-42563963 GATTCACTGCTCAGGGGAACAGG + Intronic
1180081660 21:45490133-45490155 CAGCCCCTGCTCAGGCCCACAGG + Intronic
1180346257 22:11706228-11706250 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1180569247 22:16700319-16700341 CTGGCAGTGCTCAGGGTCACTGG + Intergenic
1180981484 22:19880053-19880075 CAGCCACTGCTCAGGGCCCCTGG + Intronic
1181285433 22:21748538-21748560 AGGTCACAGCCCAGGGACACAGG + Intergenic
1181433383 22:22896158-22896180 GGGTCACTGCTCAGGGACAGGGG + Intergenic
1181466939 22:23115443-23115465 TAGGCAGTCCTCAGGGACACTGG - Intronic
1181518435 22:23431713-23431735 CAGTAACTGTTCACAGACACTGG - Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1183435589 22:37792698-37792720 CAGGCATTGGTGAGGGACACAGG - Intergenic
1183975261 22:41508361-41508383 CCCTCACTGCTCAGGCAGACAGG - Intronic
1184316987 22:43702036-43702058 CAGTCAGTGCCCAGGTACATGGG + Intronic
1185087743 22:48749780-48749802 CAGACGCTGCCCAGGGCCACAGG - Intronic
949128405 3:472928-472950 AAGTGACTTCTCAGGGACACTGG - Intergenic
949348261 3:3097577-3097599 AAGTCACAGCTCAAGGACAGAGG + Intronic
950656013 3:14436808-14436830 CAGTCAGTGCCAAGGGCCACAGG - Intronic
950672161 3:14533748-14533770 CAGTGACAGCTTAGGGACAGCGG + Intronic
954809609 3:53240010-53240032 CAGTCACTGCTGAGGGACCCAGG + Intronic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
955207338 3:56908194-56908216 CAGTCCCCGCTCGGGGTCACTGG - Intronic
955814868 3:62831424-62831446 CAGTCACTGATTAGGGAATCAGG + Intronic
958592608 3:96177236-96177258 GAGTCACTGCTTGGGGCCACTGG - Intergenic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
962757514 3:138477278-138477300 CAGTCACTGCCCAGGAATGCTGG - Exonic
963025090 3:140911456-140911478 CAATCACTGCTCAAGGGGACAGG - Intergenic
963136318 3:141908600-141908622 CAGTATCTGCTCAGGGGCAGGGG - Intronic
963744733 3:149114900-149114922 CAGTCACTGTCCAGGGAGATGGG + Intergenic
963830547 3:150003708-150003730 CAATCAAAGCTCAGGGACAATGG - Intronic
965037634 3:163462176-163462198 AGGTCACAGCTCAGAGACACAGG + Intergenic
965129191 3:164673044-164673066 CAGTCATAGCTCAGAGACAGAGG - Intergenic
966413085 3:179663375-179663397 CAGTCATCTGTCAGGGACACTGG + Intronic
966912013 3:184564998-184565020 CAGCCAGGGCTCAGGGACCCTGG - Intronic
969631556 4:8341651-8341673 CAGTCACTTCCCAGGCACACAGG - Intergenic
969683779 4:8657547-8657569 CAGGCACTGCTGGGGGGCACTGG + Intergenic
971208659 4:24594530-24594552 AGGTCACAGCTCAGGGACATAGG + Intergenic
972927844 4:44034018-44034040 TGGTCACTGCTCAGGGTCTCAGG - Intergenic
973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG + Intergenic
973383269 4:49333974-49333996 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973386877 4:49518989-49519011 CAGTCCCTGCACTGGGACCCAGG - Intergenic
973839650 4:54848139-54848161 CAGTGACTGCACAGGGAGACTGG - Intergenic
974039357 4:56844601-56844623 CAGTCACAGACCAGGGACAACGG + Intergenic
975800620 4:78056751-78056773 CAGTTCTTGCTCAGGCACACCGG - Intergenic
977329188 4:95615526-95615548 AAGTGACTGCTAATGGACACAGG - Intergenic
977952347 4:102987165-102987187 CATTCACAGCTCAGAGGCACAGG - Intronic
978401920 4:108340420-108340442 CAGGCACTGTGCAGGGAGACAGG - Intergenic
978720712 4:111905593-111905615 CAGTCACTGGCCAGGGATTCAGG - Intergenic
979795489 4:124841506-124841528 CTGTCACTGATCAGAGAGACTGG + Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
982113316 4:152075778-152075800 CTGTCCCTGCTCAGGGAAGCAGG + Intergenic
983069735 4:163254222-163254244 CTGTCCCTGCTGAGGGGCACCGG + Intergenic
983657840 4:170100973-170100995 CAGCCACTGCTGAGGGAAAGGGG - Intergenic
986283624 5:6344112-6344134 GAGTCACTGCACTGGGGCACGGG + Intergenic
986439025 5:7762399-7762421 CAGTCAGAGCTCAGGGGCCCAGG - Intronic
988309963 5:29543976-29543998 CAAACACTGCCCAGGGATACTGG - Intergenic
989102296 5:37834645-37834667 CAGTCACTGCTCAGCGCGAAGGG + Exonic
989388843 5:40879918-40879940 CACTGAATGCTCAGGGAGACTGG - Intergenic
990792631 5:59498242-59498264 CAGTCACTGCTTAGGGCCTGTGG - Intronic
992669768 5:79047598-79047620 CAGGTACAGCTCAGGGACGCGGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995321304 5:110837360-110837382 AGGTCACAGCCCAGGGACACAGG - Intergenic
996528812 5:124505522-124505544 CAGTCACTGGTCAGGGGTCCAGG - Intergenic
999421598 5:151449039-151449061 CAGACCCTGGTCAGGGGCACTGG - Intronic
1000250069 5:159485814-159485836 CAAACAATGGTCAGGGACACAGG + Intergenic
1001599384 5:172919134-172919156 CAGCCAGTGCTCAGGTAAACAGG + Intronic
1002298317 5:178243586-178243608 CAGTCAATGCTCAGTGACAGAGG + Intronic
1002310717 5:178312195-178312217 CAGGCAGTGATTAGGGACACGGG - Intronic
1002834622 6:855715-855737 GAGTCCTTGCTCAGGGACCCTGG + Intergenic
1003219417 6:4145282-4145304 CAGTGACTCCACAGGTACACAGG + Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1006945663 6:37783151-37783173 GAGTCTTTGCTCAGGGACAGGGG + Intergenic
1007303087 6:40883223-40883245 AAGTCACTGCTCTGGGAAACTGG + Intergenic
1007323200 6:41041656-41041678 CTGTCAAGGGTCAGGGACACTGG - Intronic
1008354530 6:50535687-50535709 TATTCTCTGCTCAGGTACACAGG + Intergenic
1008638248 6:53434095-53434117 CAGTCACAGCTCAGTAACATTGG - Intergenic
1011183120 6:84644025-84644047 AACTCACTGCTCAGGGAAAGAGG + Intergenic
1011629583 6:89311112-89311134 CGGTCACTGCCCAGAGACCCAGG - Intronic
1013042617 6:106450957-106450979 CAGTTACTGGTGAGGGAAACTGG + Intergenic
1013226310 6:108121380-108121402 CAGTCACTTCTCTGGGCCCCAGG - Intronic
1014126628 6:117783537-117783559 CAGCCACTCCTCAGGGAAACTGG + Intergenic
1014289423 6:119540649-119540671 CAGCCACTGCACAGACACACTGG - Intergenic
1016045661 6:139477897-139477919 CAGTCACTTCACAGGGGCAGAGG + Intergenic
1016995995 6:149962874-149962896 CTGTGACTGAGCAGGGACACAGG - Intergenic
1017002595 6:150006291-150006313 CTGTGACTGAGCAGGGACACAGG + Intergenic
1017005822 6:150027509-150027531 CTGTGACTGTGCAGGGACACAGG + Intergenic
1017012189 6:150070295-150070317 CTGTGACTGAGCAGGGACACAGG + Intergenic
1017201694 6:151761529-151761551 CAGAAATTGCTCAGGGTCACAGG - Intronic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1018066973 6:160131306-160131328 CAGTCACTGCCCCAGGAGACAGG + Intronic
1019441595 7:1050214-1050236 CAGTGACTCCTCAGGCACAGTGG + Intronic
1023841593 7:44101421-44101443 CAGTCAGAACTCAGGCACACTGG + Intergenic
1024281372 7:47722262-47722284 CAGACGCTGCTCATGGAGACTGG - Intronic
1025241587 7:57281014-57281036 TAGTCACTGCTAAGGGAAATTGG - Intergenic
1025972728 7:66343026-66343048 AAGTCACGGCCCAGGCACACAGG + Intronic
1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG + Intronic
1026952201 7:74355069-74355091 CAGGGACTGCACAGGGACTCAGG - Intronic
1027176295 7:75905957-75905979 AAGTGACTGCTCAGAGGCACAGG + Intronic
1027684460 7:81264944-81264966 TAGTCACTGCTAAGGGGCAGGGG + Intergenic
1028317269 7:89419139-89419161 AGGTCACAGCTCAGAGACACAGG - Intergenic
1029623733 7:101706807-101706829 CAGCCAGTGCTCAGGGCCAATGG + Intergenic
1031762790 7:125735385-125735407 CAGACACTGCTAGGGGACAGAGG - Intergenic
1035276217 7:157749458-157749480 AACCCACAGCTCAGGGACACAGG - Intronic
1035276261 7:157749704-157749726 AGCTCACAGCTCAGGGACACAGG - Intronic
1039031186 8:33311435-33311457 CAGTCACTGGTAAGGGAAAGGGG + Intergenic
1039347392 8:36722661-36722683 AAGTTACAGCTCAGGGACATAGG - Intergenic
1039386834 8:37143563-37143585 CAGTCAATGGTCAAGGAAACAGG + Intergenic
1045834092 8:106499934-106499956 CATTCACTTCTCAGCGTCACAGG - Intronic
1045980358 8:108179332-108179354 AAGTCACAGCCCAAGGACACAGG + Intergenic
1047722723 8:127656601-127656623 AAGTCACTACAAAGGGACACAGG + Intergenic
1048861801 8:138729247-138729269 CAGTCCCCACTCAAGGACACGGG + Intronic
1049343923 8:142128513-142128535 CCCTCACTGCTCAGGTACAATGG - Intergenic
1049456585 8:142694768-142694790 CAGTCACAGCCCATGGTCACAGG - Intergenic
1049816646 8:144606139-144606161 CAGTCACTGGGGAAGGACACGGG + Intergenic
1049889154 9:52080-52102 CAGTTACTGCTGAAGGCCACAGG - Intergenic
1050620811 9:7450118-7450140 GAGTCACTGCACAGGGCCCCTGG + Intergenic
1051605916 9:18917709-18917731 CAATCACTTCTCAGGGACCATGG + Intergenic
1052759210 9:32572757-32572779 CGCTCAGTGCTCTGGGACACTGG - Intronic
1053376737 9:37613641-37613663 CTGCCACAGCTCAGTGACACTGG + Intronic
1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG + Intergenic
1053762712 9:41357278-41357300 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1054541315 9:66268392-66268414 CAGTCCCTGCACTGGGACCCGGG - Intergenic
1056454633 9:86747939-86747961 CAATGCCTGCTCATGGACACAGG + Intergenic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1057096387 9:92313825-92313847 CAGTCACAGTTCAGTTACACAGG - Intronic
1057724913 9:97561638-97561660 CAATCACTGCTGGGGGAAACAGG - Intronic
1057825401 9:98369129-98369151 CAGCCACAGCTGAGGAACACTGG + Intronic
1058814578 9:108671398-108671420 GAGTCCCTCCTCTGGGACACTGG - Intergenic
1058947826 9:109875416-109875438 AAGTCACAGCTCAGGAAGACAGG - Intronic
1059457821 9:114410873-114410895 CACTCACTGATTAGTGACACTGG + Intronic
1060920849 9:127419290-127419312 CAGTCACTGAGCAGTGAGACAGG + Intergenic
1061588713 9:131584459-131584481 CAGTCCCTGCTCTGGGAGCCCGG - Intronic
1061641506 9:131961048-131961070 CTGCCACAGCTCAGGGAAACTGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1062116720 9:134813606-134813628 CACGCAGTCCTCAGGGACACAGG - Intronic
1203697817 Un_GL000214v1:114176-114198 CAGTCCCTGCACTGGGACCCAGG + Intergenic
1203551385 Un_KI270743v1:166810-166832 CAGTCCCTGCACTGGGACCCAGG - Intergenic
1186280615 X:7988957-7988979 AAGTCACTGCCCCGAGACACCGG - Intergenic
1186492697 X:9986430-9986452 GAGTGACTGCTCATGGGCACAGG + Intergenic
1186508955 X:10116211-10116233 CAGGCACTGCTCAGGGTGCCAGG + Intronic
1186822523 X:13305125-13305147 ATGTCACAGCTCAGGGACTCAGG - Intergenic
1186860047 X:13663948-13663970 CAGCCACTGCTGAGAGCCACAGG - Intronic
1190581273 X:51894529-51894551 CAGTCCCTGCTCAGAGAGAGGGG + Intronic
1190911341 X:54774955-54774977 CAGGCTCTGCCCAGGGCCACAGG + Intronic
1190919882 X:54841260-54841282 CAGGCTCTGCCCAGGGCCACAGG - Intergenic
1192664652 X:73076812-73076834 CAGTATTTTCTCAGGGACACAGG - Intergenic
1193225784 X:78982169-78982191 CAGTGGCTGTTCAGGGAAACAGG + Intergenic
1194105617 X:89763198-89763220 AGGTCACAGCCCAGGGACACAGG - Intergenic
1194520035 X:94908232-94908254 CAGTCACCACTCATGCACACTGG + Intergenic
1196853414 X:119960800-119960822 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196858893 X:120008891-120008913 AGGTCACAGCCCAGGGACACAGG + Intergenic
1200457580 Y:3411023-3411045 AGGTCACAGCCCAGGGACACAGG - Intergenic
1201306296 Y:12553597-12553619 CAGAGACTGCTCATGGACAGAGG + Intergenic