ID: 1113908910

View in Genome Browser
Species Human (GRCh38)
Location 13:113832651-113832673
Sequence CTTGAAGCGCAGTCGGATCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113908901_1113908910 13 Left 1113908901 13:113832615-113832637 CCTGTGGACACCTCCTCACCTGG 0: 1
1: 0
2: 3
3: 33
4: 267
Right 1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG 0: 1
1: 0
2: 0
3: 0
4: 28
1113908905_1113908910 3 Left 1113908905 13:113832625-113832647 CCTCCTCACCTGGTGGGCTGCAG 0: 1
1: 0
2: 7
3: 30
4: 305
Right 1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG 0: 1
1: 0
2: 0
3: 0
4: 28
1113908907_1113908910 -5 Left 1113908907 13:113832633-113832655 CCTGGTGGGCTGCAGCCTCTTGA 0: 1
1: 1
2: 0
3: 20
4: 205
Right 1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG 0: 1
1: 0
2: 0
3: 0
4: 28
1113908900_1113908910 16 Left 1113908900 13:113832612-113832634 CCTCCTGTGGACACCTCCTCACC 0: 1
1: 1
2: 1
3: 33
4: 307
Right 1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG 0: 1
1: 0
2: 0
3: 0
4: 28
1113908906_1113908910 0 Left 1113908906 13:113832628-113832650 CCTCACCTGGTGGGCTGCAGCCT 0: 1
1: 0
2: 4
3: 31
4: 312
Right 1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113908910 Original CRISPR CTTGAAGCGCAGTCGGATCA CGG Exonic
1076144045 10:128102849-128102871 CTTGAAGGGCAGTGGGGGCAGGG + Exonic
1090815371 11:130289429-130289451 CTGGAAGTGCAGTGGGATCTCGG - Intronic
1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG + Exonic
1128246794 15:66138538-66138560 CTTGCAGCCCGGTCGGGTCACGG + Intronic
1129415680 15:75377246-75377268 CTTGAATTGCAGTCGCATGAAGG - Intronic
1130086764 15:80784126-80784148 CTGGAAGGGCAGTCATATCAGGG + Intronic
1136991421 16:35153392-35153414 CTGGAAGCACAGTGGGGTCAAGG + Intergenic
1153610267 18:6877553-6877575 CGTGAAGCGAGGTCGGAGCAGGG + Intronic
925883196 2:8369935-8369957 CTTGAAGGCCAGTAGGATTAAGG - Intergenic
929574090 2:43041454-43041476 CTGGGAGCCCAGTCTGATCATGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
941500615 2:166271325-166271347 CTTAAATCGCAGTTGGGTCAGGG - Intronic
943334298 2:186595361-186595383 CTTGAAGGGCAGTTGATTCACGG - Intronic
946529829 2:220559093-220559115 CTTGAAGTGCACCCAGATCAAGG - Intergenic
955168527 3:56539926-56539948 CTAGAAGGGCAGTCGGAGAAGGG - Intergenic
969516862 4:7652766-7652788 CTTGAAACGCTGTCTGACCACGG + Intronic
980801641 4:137758837-137758859 CCTCAAGAGCAGCCGGATCATGG + Intergenic
991648627 5:68828526-68828548 CTTGATGAGCAGACGGATCGTGG - Intergenic
1003284241 6:4720799-4720821 ATTGAAAAGCATTCGGATCATGG + Intronic
1012849771 6:104432463-104432485 CTTGAAGAGTAGAAGGATCAAGG + Intergenic
1018725648 6:166611656-166611678 CTTCAAGCTCAGGCTGATCAGGG + Intronic
1019855824 7:3606365-3606387 CTTGTAGCCCAGTTGCATCAGGG + Intronic
1023316831 7:38946725-38946747 CCTGTAGGGCAGTCGGGTCAGGG - Intergenic
1027188623 7:75985736-75985758 CTTGAAGGGCAGGCGGAACTGGG - Exonic
1029743272 7:102503184-102503206 CTTGTAGCGCACTCGGACGAAGG + Exonic
1029761261 7:102602345-102602367 CTTGTAGCGCACTCGGACGAAGG + Exonic
1030216489 7:107048322-107048344 CTTGAAGCCCAGGATGATCAGGG + Intronic
1042347119 8:67739086-67739108 CTTGAAGCCCAATCTGATAATGG - Intronic
1189986958 X:46562021-46562043 CTTGAAGGGCAGTGGGGGCAGGG + Intergenic