ID: 1113909253

View in Genome Browser
Species Human (GRCh38)
Location 13:113834457-113834479
Sequence GAAACACTTCCGTGAAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909253_1113909256 1 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909256 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 51
1113909253_1113909260 9 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909260 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 2
3: 13
4: 212
1113909253_1113909265 23 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909253_1113909258 2 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909258 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1113909253_1113909254 -4 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909254 13:113834476-113834498 TTTCTCCCGAAAGCCCCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 110
1113909253_1113909266 24 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909253 Original CRISPR GAAACACTTCCGTGAAGACC TGG (reversed) Intronic
900133189 1:1098976-1098998 CAAACACATCAGTGAAGACATGG - Intronic
903353038 1:22729666-22729688 GGAACACTTCCTTGAAAACATGG - Intronic
907040785 1:51257334-51257356 GAAGCACTCACGTGAGGACCTGG + Intronic
907597804 1:55735758-55735780 AAAACACTTCCGTGAAATGCTGG + Intergenic
908026196 1:59954114-59954136 GACACACTTCCGTGAATATCAGG - Intergenic
908186956 1:61661460-61661482 GAAACACTTCAGAAAAGATCTGG + Intergenic
919748020 1:201020680-201020702 GAAACGCTTCAGTGAAGGCCTGG - Intronic
920853821 1:209647579-209647601 GACACACTTCCCTGAAGCCAAGG - Intronic
920871215 1:209796732-209796754 GAAACACTGCCCTTAGGACCAGG + Intronic
1063176054 10:3552028-3552050 GAAACCCTTGCATGGAGACCAGG + Intergenic
1064798142 10:19037319-19037341 GAAACAATTGCAAGAAGACCAGG + Intergenic
1064966429 10:21019548-21019570 GAAACACATCAGTTAAGACTAGG - Intronic
1066530915 10:36338021-36338043 GACAAACTTCCTTGAAGAACTGG - Intergenic
1067519343 10:46984483-46984505 GAAACACTTCCGTGTATTCCTGG + Exonic
1067642904 10:48067356-48067378 GAAACACTTCCGTGTATTCCTGG - Intergenic
1068681721 10:59827147-59827169 GAAACAGATCCATGAAGATCTGG + Intronic
1071060470 10:81564552-81564574 GGAAGTCTTCTGTGAAGACCAGG - Intergenic
1072442251 10:95467490-95467512 GAAATATTTCCGTGAAGGGCCGG + Intronic
1072828864 10:98636747-98636769 GAAACACTTCCTTTATGACTGGG + Intronic
1077773625 11:5247953-5247975 GAAAAGGTTCAGTGAAGACCTGG - Intergenic
1079163389 11:18013978-18014000 GAGACACTTCCCAGAAGCCCAGG - Intergenic
1079267416 11:18947216-18947238 GAAACACTTCCTTTAAAAACTGG + Intergenic
1080408479 11:32001072-32001094 GAAGCACTTCCTAGAAGTCCTGG + Intronic
1082812853 11:57489111-57489133 GAAACACTTCCTGGAGAACCCGG + Intronic
1086114446 11:83232667-83232689 AAAGCACTTCCTTTAAGACCTGG - Intronic
1092123652 12:6061242-6061264 GAAGCACCCCCTTGAAGACCGGG + Intronic
1092150136 12:6242226-6242248 GAAACAATTCCCTGTACACCTGG - Intergenic
1098740355 12:74166311-74166333 GAAACATTTCCCTGGAGAACTGG + Intergenic
1101517573 12:105451167-105451189 AAAACACTTCAGTAAAAACCAGG - Intergenic
1104503984 12:129313123-129313145 GAAACTCTTCCTTGAACCCCAGG - Intronic
1113909253 13:113834457-113834479 GAAACACTTCCGTGAAGACCTGG - Intronic
1121528387 14:94635380-94635402 GACACACTTCCGTGATTATCTGG - Intergenic
1121967219 14:98321481-98321503 GAAACACTTCCCCTAAGGCCTGG + Intergenic
1125008820 15:34848189-34848211 GAAATACTTCATTGAAAACCTGG + Intergenic
1126229962 15:46312856-46312878 GAAAAAATTCTCTGAAGACCAGG + Intergenic
1129565951 15:76623971-76623993 GAAGCATTTCCCTGAAGAACAGG + Intronic
1135496415 16:22955561-22955583 GAAACATTTCACTGCAGACCTGG - Intergenic
1136015036 16:27391676-27391698 GAAAAGCTTCCGTGTATACCAGG + Intergenic
1136346680 16:29680335-29680357 GAAACACTTCCTTGAAGCGTTGG - Intronic
1139342919 16:66281527-66281549 GAAACACTTCCCTTGAGAACAGG + Intergenic
1144345720 17:14347219-14347241 GTAACCCTTCTGTCAAGACCTGG - Exonic
1147692954 17:42329201-42329223 GGAACATTTCCGTGAATATCTGG - Intronic
1149911839 17:60573909-60573931 GAAAGAATTCCCTGAAGAGCTGG - Intronic
1150439574 17:65180217-65180239 GAAGCATCTCCATGAAGACCTGG + Intronic
1155562750 18:27097309-27097331 GAACCATTTCCGTGGAGAACTGG + Intronic
1161376568 19:3942111-3942133 GGAGCTCTTCCGTGAAGTCCTGG + Exonic
1167602970 19:50465195-50465217 GACACACCACCGTGAACACCAGG - Intronic
925843634 2:8016301-8016323 GAACCACTTCCACGAAAACCTGG - Intergenic
930455871 2:51606455-51606477 GAAGCAGCTCCATGAAGACCTGG - Intergenic
931640769 2:64379254-64379276 GGAACTTTTCCCTGAAGACCCGG - Intergenic
934621646 2:95813445-95813467 GAAACACATCAGTTAAGACTGGG - Intergenic
934811795 2:97285372-97285394 GAAACACATCAGTTAAGACCGGG + Intergenic
934825896 2:97422568-97422590 GAAACACATCAGTTAAGACCGGG - Intergenic
939568049 2:143808034-143808056 GATACACTGCAGTGAAGATCTGG - Intergenic
939987490 2:148844745-148844767 GAAACATTTCCCTTAAGAACAGG - Intergenic
940254757 2:151717078-151717100 CACACACTTCCGTGAAGAGCTGG - Intronic
940526096 2:154815907-154815929 GAAACACTTCCCTGATGAGTAGG - Intronic
941885216 2:170520814-170520836 TAAAGGCTTCCGTGAAGAACAGG - Intronic
942937090 2:181570559-181570581 GAAAAACTTCCGGGAGAACCTGG - Intronic
943001020 2:182328907-182328929 GAAACCCTTCCATAAAGCCCAGG - Intronic
946238827 2:218341681-218341703 GAAACACTTCACTGAAGGCTGGG - Intronic
947388165 2:229613096-229613118 GAAAATCTTCCCTGAAGAGCTGG - Intronic
947779952 2:232750535-232750557 GAAAGACTTCCCTGAAGATTTGG + Intronic
1174764420 20:53239013-53239035 GAAAGAGTTCCCTCAAGACCTGG + Intronic
1178047944 21:28716689-28716711 GAAGCATTTCCCTTAAGACCTGG - Intergenic
1179769927 21:43606929-43606951 GAAACACTTCCCCTAAGAACTGG + Intronic
1182297672 22:29319119-29319141 GAAACACATGGGTGAAGGCCAGG - Intronic
1183015862 22:34986057-34986079 GAGACACAGCCCTGAAGACCTGG + Intergenic
1184233074 22:43168879-43168901 GGAACAGCTCCGTGAAGGCCCGG + Exonic
1184533907 22:45073477-45073499 TAAAAACTTCCGCGAAGGCCGGG + Intergenic
952991184 3:38832372-38832394 GAAGCACTTCCCTAAAGAGCTGG + Intergenic
954661431 3:52228938-52228960 GAAACACTTTCCTGGAGCCCAGG + Exonic
957119179 3:76067628-76067650 GAAACATTTCCGAGAGGGCCTGG + Intronic
958458067 3:94358327-94358349 GAAACAATTCTTTGAAGATCAGG - Intergenic
959518965 3:107304274-107304296 GAAAGACCTCAGTGAAGACCTGG + Intergenic
959550684 3:107653083-107653105 GAAAAATTTCCATGTAGACCAGG - Intronic
960873637 3:122275559-122275581 GAAACACTTTCTTGAAGATGGGG - Intronic
976155246 4:82137270-82137292 GAAACATTTCCTTGAGAACCGGG + Intergenic
981724453 4:147832984-147833006 GAAAACCTTCCGTTGAGACCTGG + Intronic
982660647 4:158202173-158202195 GAGACATTTCAGTGAAGGCCTGG - Intronic
983299540 4:165907987-165908009 GAAGCACTTCCGTGGTGAACTGG - Intronic
984758541 4:183344883-183344905 GAGACATTTCCTTGAAGCCCTGG - Intergenic
988406034 5:30824000-30824022 GAAACATTTCCCTTAAGAGCAGG - Intergenic
988965478 5:36412663-36412685 GAAGCTCTTCCGTTAAGATCAGG + Intergenic
988992629 5:36686281-36686303 GAAACACTTTCTTGAGCACCAGG + Exonic
991576840 5:68113395-68113417 GATACATTTCCTTGAAGATCTGG + Intergenic
996763682 5:127013344-127013366 GAAAAGCTTCCGTTAAGACAGGG + Intronic
997203895 5:132030217-132030239 GAAAAACTTGCGTAAAGGCCTGG + Intergenic
997929702 5:138062138-138062160 GAAAAACTTCAGTGTAAACCTGG - Intergenic
1000567707 5:162870888-162870910 GAAACACTTAAGTGAAGAAACGG - Intergenic
1002082624 5:176746430-176746452 CAAACAATACCGTGATGACCTGG - Intergenic
1004475626 6:15968527-15968549 GATACTCTTCCCTCAAGACCAGG + Intergenic
1011708679 6:90029059-90029081 GAAATACTTACGTGAAGAAAAGG - Intronic
1012556218 6:100515765-100515787 GAAACACTACCCTGAAGAGAGGG + Intronic
1018222735 6:161597194-161597216 CTAACACTTCTGTGAAGCCCTGG - Intronic
1018542955 6:164902919-164902941 ATAACACTTCACTGAAGACCTGG + Intergenic
1032889151 7:136175297-136175319 CAAACACTTCCCTGAACCCCAGG - Intergenic
1033269706 7:139919798-139919820 GAAACACTGCCCTGAGGAGCAGG - Intronic
1035043248 7:155946164-155946186 GAAAGACTTCCTTGGAGTCCTGG - Intergenic
1035107243 7:156452131-156452153 GAACCATGTCGGTGAAGACCAGG - Intergenic
1039338213 8:36618328-36618350 GAAACATTTCCTTTAAGAACAGG - Intergenic
1047870488 8:129076894-129076916 GAAGCACTTCCTTCAATACCTGG + Intergenic
1052884966 9:33636599-33636621 GAAACACTTCTGTGAAAATCAGG + Intergenic
1055990211 9:82097566-82097588 GAAACATTTCCCTTAAGAACTGG - Intergenic
1056090026 9:83196236-83196258 GAAACATTTCCAGGGAGACCAGG - Intergenic
1059904322 9:118964953-118964975 GAACCACATTTGTGAAGACCTGG - Intergenic
1060035560 9:120252674-120252696 GAAACAATTGTGTGAAGACTGGG + Intergenic
1061139180 9:128753844-128753866 GATCCACCTCCGTGAGGACCTGG - Exonic
1061777419 9:132974753-132974775 GTAACATTTCCGCTAAGACCTGG + Intronic
1199350936 X:146798853-146798875 GAAACACACCTCTGAAGACCAGG + Intergenic