ID: 1113909255

View in Genome Browser
Species Human (GRCh38)
Location 13:113834481-113834503
Sequence CCTCGCCGGTGGGGGCTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909255_1113909273 9 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909255_1113909265 -1 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909255_1113909272 8 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909255_1113909271 7 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909271 13:113834511-113834533 GAACCACCGTGAAGGGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1113909255_1113909278 16 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909255_1113909266 0 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909255_1113909276 14 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909255_1113909277 15 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909255 Original CRISPR CCTCGCCGGTGGGGGCTTTC GGG (reversed) Intronic
901455468 1:9360577-9360599 CCTCGCCCCTGGGGGCTGCCGGG + Intronic
903364184 1:22795859-22795881 CCCCGCCGGGGGAGGTTTTCCGG + Intronic
904210264 1:28882628-28882650 CCTAGGCAGTGGGGCCTTTCAGG + Intergenic
905012996 1:34759679-34759701 CCTTGCTGGGTGGGGCTTTCTGG - Intronic
920557721 1:206916284-206916306 CCACACAGGTGGGGGCTGTCTGG - Intronic
920679899 1:208064390-208064412 CCTGGCAGGTGTGGTCTTTCTGG + Intronic
922496408 1:226061915-226061937 CCTCGCCGGTGTTGGCCTCCGGG - Intronic
1067685771 10:48465349-48465371 CCTCTCCGGTGTGGGATTCCCGG - Intronic
1074884820 10:117685274-117685296 CCTCACCTGGGGGGGCTTTTAGG + Intergenic
1077250268 11:1557701-1557723 CCTGGACGGTGGGGTCATTCTGG + Intronic
1081529770 11:43950148-43950170 ACTCGAAGGTGGGGGCTTCCGGG - Intergenic
1088606754 11:111540604-111540626 CCTCGCTGGAGGAGGCTGTCGGG + Intronic
1095523476 12:43096228-43096250 CCCCTCCTGTGGGGGCTGTCAGG + Intergenic
1096980375 12:55725177-55725199 TCTCGCAGGTGGGACCTTTCTGG + Intergenic
1097057551 12:56258740-56258762 CCTAGTCTGTGGGGGATTTCGGG - Intergenic
1097891333 12:64780702-64780724 CCTCGCCGGTGGTGCCCTCCCGG - Intergenic
1105830696 13:24161073-24161095 CCCCGCCGGTGGAGGCTACCGGG + Intronic
1113909255 13:113834481-113834503 CCTCGCCGGTGGGGGCTTTCGGG - Intronic
1115257752 14:31420612-31420634 GCTCGCCGCTGAGAGCTTTCCGG - Intronic
1115392214 14:32866335-32866357 CCTGGCATGTGGGTGCTTTCTGG + Intergenic
1116248867 14:42455889-42455911 CCTCACCTGTAGGGGCCTTCTGG - Intergenic
1128838724 15:70832328-70832350 CTCCGCCAGTGGGGACTTTCTGG + Exonic
1133021234 16:2967839-2967861 CCCCGGCGCTGGGGGCTTCCAGG + Exonic
1136547969 16:30965996-30966018 CCCCCCCGGTGGGGCCTTTGGGG + Exonic
1137270986 16:46902026-46902048 CCTCTCAGTTGGGGGCTTCCAGG - Intronic
1137623637 16:49893627-49893649 CTTCGCCTGTGGGTGCTCTCTGG - Intergenic
1141981396 16:87552370-87552392 CCTGGCCTGTGGGTGCTTTGAGG + Intergenic
1142504239 17:352732-352754 CCTCCCTGGTGGGGCCTGTCTGG - Exonic
1142520800 17:503250-503272 ACCCGCCGGTGCGGGCTTCCTGG + Intergenic
1142694478 17:1626205-1626227 CCTCCCTGGTGGGCTCTTTCAGG - Intronic
1142968600 17:3596342-3596364 GCTCGCCACTGGGGACTTTCTGG + Intronic
1152351063 17:79784367-79784389 CCCCACCGCTGGGGGCCTTCGGG - Exonic
1152743385 17:82028375-82028397 CCTCCCTGGTGCCGGCTTTCAGG + Exonic
1156144557 18:34159617-34159639 CCTCGCCGGAGGGGTCCCTCTGG + Intronic
1163762567 19:19145665-19145687 CCTCCGCGGTGGGGGCTTGGAGG - Exonic
925821650 2:7804976-7804998 CCTCTCCAGTGGGTGGTTTCTGG + Intergenic
930857024 2:56029892-56029914 GCTGGCAGGTGGGGGCTTTCTGG + Intergenic
933437653 2:82269026-82269048 CCTTGCCCTTGGGGGCTTCCTGG + Intergenic
934555226 2:95283530-95283552 CCTCTCGGGTGGGGGCCTTCGGG - Intronic
937433961 2:121864672-121864694 CCTCACTGGTGGGGGCTGTGGGG + Intergenic
946412544 2:219522460-219522482 CCTCCCCAGTGGGGGCTCACGGG + Intronic
947928018 2:233938292-233938314 CCTCGCCTGTGGGGCTTTTCAGG + Intronic
948569007 2:238905559-238905581 CCTGGCCAGTGGTGGGTTTCAGG - Intronic
1171533829 20:25869033-25869055 CCTGGGCGGTGGAGGCTTTGGGG - Intergenic
1178708070 21:34890258-34890280 CCGCGCCGTCGGGGGCGTTCCGG - Intronic
1179502693 21:41820041-41820063 CCTCGCTGGAGGGGGCTGGCAGG - Intronic
1183986975 22:41575379-41575401 CCTGGCCGATGGGTGCTTTTGGG + Exonic
1184841543 22:47055144-47055166 CCTGGCAGGTGTGGGCTTTGGGG - Intronic
950809217 3:15635496-15635518 CCTCCCCGGTGTGGGCTCCCAGG - Exonic
956787213 3:72652592-72652614 CCTCGAGGGTGGGGGCTGGCAGG - Intergenic
960631660 3:119738243-119738265 GCTGGCTGGTGGGAGCTTTCTGG - Intronic
965757420 3:172040317-172040339 CCGCGCCGGCGGGGGCGGTCGGG + Intronic
967650433 3:191978873-191978895 CCTTGCAAGTGGGGTCTTTCAGG - Intergenic
968502698 4:958436-958458 CCTGGCCCGTGGGGGCTGGCGGG - Exonic
969231764 4:5836893-5836915 CCTTGCCAGTGGGGACTTGCAGG - Exonic
975620675 4:76293101-76293123 CCTCTCCAGTGGGGGCCTTTGGG + Intronic
982856308 4:160386091-160386113 CCAAGCCTGTGGGGGCTTCCTGG + Intergenic
990955165 5:61332835-61332857 CCCCGTCGGTGGGGGCTGCCGGG + Exonic
994097515 5:95860274-95860296 CCTCACTGGTGTGGGCTCTCTGG + Intergenic
1002782385 6:377356-377378 CCTCCCCAGTGTGGGCTTTGGGG - Intergenic
1002981438 6:2142528-2142550 CCTTGCCGCTGGTGGTTTTCTGG - Intronic
1003109024 6:3238195-3238217 CCTCGCCATGGGGGGCTTCCGGG + Intronic
1017807086 6:157955143-157955165 CACCGCCGGGAGGGGCTTTCTGG + Intergenic
1029222139 7:98998983-98999005 CCCCGCCTGTGGGGGCCTGCAGG - Intronic
1031779427 7:125942643-125942665 CCTCACCTGTAGGGGCTTGCTGG + Intergenic
1034284103 7:149873412-149873434 CAGCGCCGCTGGGGCCTTTCTGG + Exonic
1035475813 7:159143850-159143872 CCTCGAGGGTGGGCGCTTTGCGG - Intronic
1035761631 8:2072983-2073005 CCCCGCCCGTGGGGGATTACAGG - Intronic
1039491078 8:37947874-37947896 CCACCCAGGTGGGTGCTTTCAGG - Intergenic
1040284799 8:46094255-46094277 CCTCCCGGGTGGGGGTTTTCTGG + Intergenic
1044286278 8:90414852-90414874 CCTCCCCTCTAGGGGCTTTCTGG + Intergenic
1049098759 8:140564318-140564340 CTTCGCCCATGGGGGATTTCAGG + Intronic
1053566543 9:39258383-39258405 CCTTGCCGGTGGTGGCTTAATGG - Intronic
1053809621 9:41839135-41839157 CCTCGCCGGAGGGGGAGTGCAGG + Intergenic
1053832321 9:42096243-42096265 CCTTGCCGGTGGTGGCTTAATGG - Intronic
1054130603 9:61360629-61360651 CCTTGCCGGTGGTGGCTTAATGG + Intergenic
1054620971 9:67348293-67348315 CCTCGCCGGAGGGGGAGTGCAGG - Intergenic
1056680045 9:88709165-88709187 TCTCACCCTTGGGGGCTTTCTGG - Intergenic
1195909615 X:109876104-109876126 CCTCACTGCTGGGGGCTTGCGGG + Intergenic
1198378468 X:136062077-136062099 CCTCCCCGGGGCGGACTTTCAGG + Intergenic