ID: 1113909257

View in Genome Browser
Species Human (GRCh38)
Location 13:113834482-113834504
Sequence CCCTCGCCGGTGGGGGCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909257_1113909271 6 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909271 13:113834511-113834533 GAACCACCGTGAAGGGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1113909257_1113909278 15 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909257_1113909276 13 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909257_1113909265 -2 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909257_1113909266 -1 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909257_1113909273 8 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909257_1113909272 7 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909257_1113909277 14 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909257 Original CRISPR CCCTCGCCGGTGGGGGCTTT CGG (reversed) Intronic
900778206 1:4600303-4600325 CCCTTCCAGGTGGGGGCATTAGG - Intergenic
901455466 1:9360576-9360598 CCCTCGCCCCTGGGGGCTGCCGG + Intronic
905769648 1:40629257-40629279 CCCTCCCAGGTGAGGGATTTTGG - Exonic
906069697 1:43007763-43007785 CCCTCTCCTGCGTGGGCTTTTGG + Intergenic
907430744 1:54409893-54409915 CTGTCACCGGAGGGGGCTTTGGG - Intronic
915856886 1:159397627-159397649 CCATGGGCGGTGGGGGCTATGGG + Intergenic
915954701 1:160212193-160212215 CCCTCACAGCTGGAGGCTTTAGG + Intronic
920274648 1:204795144-204795166 CCCTCCCAGGGGGGCGCTTTTGG + Intergenic
920656973 1:207884508-207884530 GCCTCTTCGATGGGGGCTTTAGG + Intronic
920989129 1:210919701-210919723 GCCTCACCAGTGTGGGCTTTGGG - Exonic
922496410 1:226061916-226061938 CCCTCGCCGGTGTTGGCCTCCGG - Intronic
1063407957 10:5813987-5814009 GCGTTGCCGGTGGGCGCTTTAGG + Intronic
1070325253 10:75384695-75384717 CCCAACCAGGTGGGGGCTTTGGG - Intergenic
1070493395 10:76998738-76998760 CCCTCGCTGGTGGTGGAGTTGGG - Intronic
1070531593 10:77341975-77341997 CCCTCACCAGAGGGGTCTTTTGG - Intronic
1071292548 10:84197970-84197992 CCCTCTCCTGTGGGCACTTTGGG - Intronic
1074147425 10:110729288-110729310 CCCTCGCAGGAGAGAGCTTTGGG - Intronic
1076208976 10:128625577-128625599 CCCTCCCTGGGGAGGGCTTTTGG + Intergenic
1076790217 10:132773071-132773093 CCCTCCCCGGTGGAGGCCTCTGG + Intronic
1082996934 11:59262376-59262398 CCCTGGGAGGTGGGGGCCTTTGG - Intergenic
1083272324 11:61578770-61578792 TCCTCTCCGGTGTGGGCATTGGG - Intronic
1083457252 11:62787248-62787270 CGCCCGCCGGTGGGCGCTCTCGG + Exonic
1083723380 11:64614897-64614919 CCCTAGCTGGTTGGGACTTTGGG + Intronic
1083775878 11:64894148-64894170 CCATCCCTAGTGGGGGCTTTTGG - Intergenic
1084148854 11:67278808-67278830 CCCGCCCCGGTGGGGGGTATCGG + Intronic
1084389471 11:68865660-68865682 CCCTGGCCTGTGGGAGCTCTGGG + Intergenic
1085323403 11:75588593-75588615 CCCTGGCCTGTGGGGGCATCTGG - Intronic
1090275028 11:125413082-125413104 CCCTCGCCTCTGGGGGCGTGGGG + Intronic
1098084631 12:66829350-66829372 CCATTTCCTGTGGGGGCTTTAGG - Intergenic
1105015607 12:132785094-132785116 CCCTCGCAAGTGGTGACTTTTGG - Intronic
1105830694 13:24161072-24161094 CCCCCGCCGGTGGAGGCTACCGG + Intronic
1112503558 13:99959768-99959790 CCCTCGCCGGTGGGCCCTGGAGG + Intergenic
1113909257 13:113834482-113834504 CCCTCGCCGGTGGGGGCTTTCGG - Intronic
1117433464 14:55694138-55694160 CCCTGGCCTCTGAGGGCTTTGGG + Intronic
1118966946 14:70595751-70595773 ACCTGGCGGGTGGGGTCTTTTGG - Intronic
1119663225 14:76465972-76465994 CCCTGCCAGGTGGGGGCTCTTGG + Intronic
1122840940 14:104462201-104462223 CCCTCTCCTGTGGGGGCTGGAGG - Intergenic
1124175326 15:27418576-27418598 GCCTCACCGGTGGGGGCCATTGG - Intronic
1132520320 16:384242-384264 CCCTCTCCGGTGGGTGACTTGGG - Intronic
1132808835 16:1788087-1788109 ACCTGGCCGGTGGGGGCTTTGGG + Intronic
1132859271 16:2062017-2062039 CCCTCCTGGGTGGGGCCTTTGGG + Intronic
1134212508 16:12289500-12289522 CCCTCTCCGGTGGTGGCGCTGGG + Intronic
1136547967 16:30965995-30966017 GCCCCCCCGGTGGGGCCTTTGGG + Exonic
1138655389 16:58488348-58488370 CCCTTGACGGAGGGGTCTTTGGG - Intronic
1139529899 16:67537855-67537877 CCCGGGCCGGTGGGGGCTGGGGG + Intronic
1141611765 16:85185690-85185712 CCCTGGTCTGTGTGGGCTTTTGG + Intergenic
1142293265 16:89202107-89202129 TCCTCGGCGCTGGGAGCTTTCGG + Intergenic
1142303060 16:89270138-89270160 CCCTACCCGGTGGGAGCTGTGGG - Intronic
1149561827 17:57612872-57612894 CCCTTGCTGGTGTTGGCTTTGGG + Intronic
1157563236 18:48663311-48663333 CCTTGGTCGGTGGGGGCTTCTGG + Intronic
1158847192 18:61456969-61456991 CCCTAGAAGGTGGGGCCTTTGGG - Intronic
1160348499 18:78153984-78154006 CCCTAACAGGTGGGGCCTTTAGG - Intergenic
1161606643 19:5218753-5218775 CCCTCCCCCGTGGAGGCTTCAGG - Intronic
1162462909 19:10823926-10823948 CTCTCCCAGGTGGGGGCTCTGGG - Intronic
925172466 2:1758877-1758899 CCCTCCCCTGTGGGAGCCTTGGG + Intergenic
925413831 2:3655943-3655965 CCCGCTCCGGTGGGGGATGTGGG + Intergenic
926300884 2:11601311-11601333 CCTTAGGCGCTGGGGGCTTTGGG + Intronic
927179434 2:20434121-20434143 GCCTGGCCTGTGGGGGCTTCAGG + Intergenic
927870441 2:26619707-26619729 CCTTCCCCGCTGTGGGCTTTGGG - Intronic
934188052 2:89763643-89763665 CCCTCTCCCGTGGGATCTTTGGG + Intergenic
934555228 2:95283531-95283553 CCCTCTCGGGTGGGGGCCTTCGG - Intronic
937433959 2:121864671-121864693 CCCTCACTGGTGGGGGCTGTGGG + Intergenic
939047518 2:137267502-137267524 CACTCGGGGGTGGGGGATTTGGG - Intronic
942024034 2:171895128-171895150 CCCTAGAGGGTGGGGGCTATAGG - Intronic
946412542 2:219522459-219522481 CCCTCCCCAGTGGGGGCTCACGG + Intronic
946921380 2:224585020-224585042 CCCTCCCCGGCGGCGGCTTCAGG + Exonic
949044600 2:241866692-241866714 CCCTTGCCGGTGGGGCCTGTGGG + Intergenic
1171533831 20:25869034-25869056 ACCTGGGCGGTGGAGGCTTTGGG - Intergenic
1177169742 21:17641806-17641828 CCCTCCCAGGTGGGGCCTGTTGG - Intergenic
1180749241 22:18112983-18113005 CCCTCCCTGGTGGGGGTTTGGGG + Intronic
1183986973 22:41575378-41575400 GCCTGGCCGATGGGTGCTTTTGG + Exonic
1184841545 22:47055145-47055167 GCCTGGCAGGTGTGGGCTTTGGG - Intronic
957630085 3:82707189-82707211 CCACAGCCGGTGTGGGCTTTGGG + Intergenic
964720671 3:159764925-159764947 CCCCAGCCGGCTGGGGCTTTTGG - Exonic
969360044 4:6657734-6657756 CCCTCGCCTGCGCGGGCTCTGGG - Intergenic
969458240 4:7313363-7313385 CCCCAGACGGTGAGGGCTTTAGG - Intronic
975620673 4:76293100-76293122 TCCTCTCCAGTGGGGGCCTTTGG + Intronic
998176551 5:139905042-139905064 CCCTGGCTGGGAGGGGCTTTTGG - Intronic
999240510 5:150124803-150124825 CCCTCGGCTCTGGGGCCTTTGGG - Exonic
1002782387 6:377357-377379 GCCTCCCCAGTGTGGGCTTTGGG - Intergenic
1006295773 6:33169402-33169424 TCATCGCCTGTGGGGCCTTTAGG + Exonic
1009615502 6:65999617-65999639 CCCTCGCCGCCTGGGGCTTGCGG + Intergenic
1022088052 7:27088057-27088079 CCCGCGTCGGTGGGTGGTTTCGG - Intergenic
1025095535 7:56092877-56092899 CCCTCTCCCCGGGGGGCTTTGGG - Exonic
1034261505 7:149759507-149759529 CCCTGGGCGCTGGGTGCTTTGGG - Intergenic
1034563394 7:151895544-151895566 CCCAGGCCGCAGGGGGCTTTTGG + Intergenic
1037835301 8:22211913-22211935 CCCTTGCTGGTGGGGGTTTGTGG - Exonic
1039912462 8:41835932-41835954 CCCTCCCTGGTGGGGCCTATGGG - Intronic
1049382591 8:142324897-142324919 CCCTCGGCTGAGGGGGCTGTGGG + Intronic
1049835051 8:144730179-144730201 CCCGCGCCTGGAGGGGCTTTAGG - Intronic
1051634471 9:19169322-19169344 GCCTAGCCGATGGTGGCTTTTGG - Intergenic
1058005272 9:99907062-99907084 CGTTCGCTGGTGGGGGCGTTTGG + Intronic
1061078005 9:128353406-128353428 CCTTCGCAGGTGGGGGCCTGTGG + Exonic
1062016190 9:134292531-134292553 CCGTCCCCGATGGGGGCTTTGGG + Intergenic
1062462111 9:136666346-136666368 CTCTCGCGGGTGGGGGCTGCGGG + Intronic
1186660609 X:11664868-11664890 CCCTGGACGCTGGTGGCTTTGGG + Exonic
1189701645 X:43719495-43719517 CCCTGGCAGGTGGGTGTTTTGGG + Intronic
1195909613 X:109876103-109876125 CCCTCACTGCTGGGGGCTTGCGG + Intergenic
1200111783 X:153744267-153744289 CCCTCTCCCGTGGGATCTTTGGG - Exonic