ID: 1113909261

View in Genome Browser
Species Human (GRCh38)
Location 13:113834490-113834512
Sequence TCCGGGGGCCCTCGCCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909261_1113909282 23 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909261_1113909276 5 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909261_1113909278 7 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909261_1113909277 6 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909261_1113909271 -2 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909271 13:113834511-113834533 GAACCACCGTGAAGGGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1113909261_1113909273 0 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909261_1113909272 -1 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909261_1113909266 -9 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909261_1113909265 -10 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909261 Original CRISPR TCCGGGGGCCCTCGCCGGTG GGG (reversed) Intronic
900370274 1:2329132-2329154 CCTGTGGGCCCTTGCCGGTGTGG + Intronic
900540302 1:3199389-3199411 TCCGGAGCCCCTTGCCAGTGGGG + Intronic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
901086123 1:6613472-6613494 TGCGGGGGCCCGCGCCGGCTCGG - Intronic
902391039 1:16106667-16106689 TCCGTGGACCCTTGCCAGTGGGG - Intergenic
903830133 1:26169726-26169748 CCCGCGGGCCCTCGCTGGGGAGG - Intergenic
913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG + Intergenic
914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG + Intergenic
914112764 1:144717630-144717652 TCCGGGGGGGCTCGAGGGTGTGG - Intergenic
916233349 1:162561662-162561684 TCCGGGGGGCCGCGGCGGCGGGG - Exonic
916749768 1:167713767-167713789 TGCGGGGTCTCCCGCCGGTGTGG - Intergenic
917055641 1:170978460-170978482 GCCAGGGGCCCTGGCTGGTGAGG + Intronic
922416638 1:225428135-225428157 CCCGGGCGGCCTCGCCGGTGGGG - Intronic
1080836480 11:35944806-35944828 CCCAGGGCCCCTCGCCGGTCAGG - Intronic
1083625249 11:64069038-64069060 TCCGGGGGCAGTGGCAGGTGGGG + Intronic
1083856548 11:65395999-65396021 TCTGTGTGCCCTCGCAGGTGGGG + Intronic
1086837318 11:91640913-91640935 TACGGGGGCCCTGTACGGTGGGG - Intergenic
1094495063 12:30984081-30984103 TGCAGGGGCCCTTGCCGCTGAGG - Intronic
1097981714 12:65742447-65742469 GCCGGGGGCGCTCCCCGGCGGGG + Intergenic
1103261478 12:119593087-119593109 TCCAGGTGCCCTCCCCAGTGTGG - Intergenic
1104925114 12:132309950-132309972 CCCGGGTGACCTCGCCGCTGAGG + Intronic
1104930941 12:132339169-132339191 TCCGGTGGGCCTCGCCGGCAGGG + Intergenic
1113705096 13:112425148-112425170 TCCGGGCGCCCACGCCACTGTGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1116801706 14:49450748-49450770 TCCGTGGGTCCTCCCGGGTGTGG - Intergenic
1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG + Intronic
1123782900 15:23645081-23645103 TCCGGGTGGCCTTGCCGGAGCGG + Exonic
1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG + Intronic
1129880662 15:79004234-79004256 CCTGGGGGCCGTCTCCGGTGGGG + Intronic
1132570486 16:641957-641979 GCCGGGGGCCGGCGGCGGTGTGG + Exonic
1133181079 16:4055163-4055185 CCTGGGGGCCCTTCCCGGTGTGG - Intronic
1141685068 16:85565530-85565552 CCATGGGCCCCTCGCCGGTGTGG - Intergenic
1142847816 17:2690651-2690673 TCCTGGGGCCCCCGCTGGCGCGG + Exonic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1150620434 17:66803790-66803812 TCCGAGGGCCCTCTCTGGGGAGG - Intronic
1152542043 17:80981436-80981458 GCCGGCGGCCCTCGCAGCTGGGG - Intergenic
1160567886 18:79798294-79798316 GCCGGAGGCGCTCGCCGGTCTGG + Intergenic
1160682081 19:416547-416569 TCTGGGGGCCCTCGCGGGGCTGG - Intergenic
1160753681 19:747220-747242 TCCCGGGGCCCTCTCTGGCGGGG - Exonic
1161398305 19:4056397-4056419 CCCGGGGGCCCTCCTCGGAGGGG - Intronic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162036119 19:7940480-7940502 TCCTGGGGCCATCGTGGGTGTGG - Intronic
1162573192 19:11484043-11484065 GCAGGGGGGTCTCGCCGGTGTGG + Exonic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1163442624 19:17329369-17329391 CCCGTGGGTCCTCGCCGGGGTGG - Intronic
1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG + Intronic
1167120576 19:47514301-47514323 TGCGTGGGCCCTGGGCGGTGAGG - Intronic
1168538457 19:57191445-57191467 TCCGACGGCTCACGCCGGTGGGG + Intergenic
925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
925170517 2:1747476-1747498 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG + Intronic
940830086 2:158457070-158457092 TCCGGGGGCGGGGGCCGGTGGGG + Intronic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG + Intronic
948461279 2:238131072-238131094 GCCGGGGGCCCTCGCTGGGCGGG - Exonic
948485291 2:238276932-238276954 CCCGGGGGCTCTGGACGGTGAGG + Intronic
948487363 2:238289226-238289248 TCCCGCGGCCCTGGCCGCTGGGG - Intronic
948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG + Intronic
1175926099 20:62472336-62472358 TCCTGGGGCCCTGGGCTGTGGGG - Intronic
1179891845 21:44339209-44339231 GCCGGGGGCGCCCGCCGGTCGGG - Exonic
1180109726 21:45642445-45642467 CCCGCGGGTCCTCGCCGGGGTGG - Intergenic
1182415929 22:30221462-30221484 GCCGTGGGCCGTGGCCGGTGTGG - Intergenic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG + Intergenic
1184036564 22:41920814-41920836 CCCCAGGGCCCTGGCCGGTGGGG - Intergenic
953026991 3:39151229-39151251 TCTGGGGTTCCTCGGCGGTGTGG - Intronic
954392195 3:50273697-50273719 TCCGGGAGCCCCCGCCGCAGCGG + Intronic
959419605 3:106112680-106112702 CCCGGCGGCGCTCGCCGGCGCGG + Intergenic
961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG + Intergenic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG + Intronic
968550803 4:1222614-1222636 GGCGGGGGCCCTGGCAGGTGGGG + Intronic
969846859 4:9926120-9926142 TCAGGGGGCACTCCCAGGTGTGG - Intronic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
985527188 5:412002-412024 TCCCGGGGCCATCACCGGTGAGG - Intronic
985663273 5:1168059-1168081 GCCGGGGGCCCTGTCCTGTGGGG - Intergenic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1007276128 6:40675385-40675407 TCAGGGGGCCCTAGCCTGAGGGG + Intergenic
1007610098 6:43143613-43143635 TCCAGGGCCCCTCACCGTTGAGG - Exonic
1024897325 7:54275154-54275176 TCCTGGGGCCCTAGCCAGGGAGG - Intergenic
1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG + Exonic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1041690296 8:60680115-60680137 GCCGGGGGTCAGCGCCGGTGGGG + Intronic
1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG + Intergenic
1047499482 8:125430642-125430664 TCCGGGAGCCCTTGCCTGCGGGG + Exonic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG + Exonic
1049694300 8:143976107-143976129 TCCCGCGGCCCACGCCGCTGCGG - Intronic
1057605891 9:96497334-96497356 TCGGGGGTCCCTGGCCTGTGTGG - Intronic
1057766330 9:97922573-97922595 TTCGCGGGACCTCGCCGGCGAGG - Intergenic
1199606899 X:149585332-149585354 TCCAGGGGGCCTCGTCGGTCTGG + Intronic
1199632224 X:149784036-149784058 TCCAGGGGGCCTCGTCGGTCTGG - Intronic
1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG + Exonic