ID: 1113909262

View in Genome Browser
Species Human (GRCh38)
Location 13:113834491-113834513
Sequence TTCCGGGGGCCCTCGCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909262_1113909282 22 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909262_1113909271 -3 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909271 13:113834511-113834533 GAACCACCGTGAAGGGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 101
1113909262_1113909278 6 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909262_1113909273 -1 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909262_1113909266 -10 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909262_1113909276 4 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909262_1113909277 5 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909262_1113909272 -2 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909262 Original CRISPR TTCCGGGGGCCCTCGCCGGT GGG (reversed) Intronic
900368830 1:2322573-2322595 TTCTGGGGGGCCTCGCCAGGGGG + Intronic
902187504 1:14736212-14736234 TTCCTGGGCCCCTGGCCTGTTGG + Intronic
903540321 1:24092982-24093004 GTCCGGGTGCCCTCGCCCTTCGG - Exonic
922416640 1:225428136-225428158 CCCCGGGCGGCCTCGCCGGTGGG - Intronic
924178561 1:241418331-241418353 TGCCGGAGGCCCTGGCCAGTGGG + Intergenic
1063458486 10:6201519-6201541 TTCCGGGGCCCCTCGGCAGGCGG + Intronic
1070145778 10:73772472-73772494 TTCCGGCCGCCCTCGGCGCTGGG + Exonic
1092243783 12:6851760-6851782 TTCCTGGGGACCTGTCCGGTCGG - Exonic
1102029014 12:109729393-109729415 TTCCGGGGGCTCTTGCTGGCCGG - Intronic
1104930940 12:132339168-132339190 CTCCGGTGGGCCTCGCCGGCAGG + Intergenic
1108037696 13:46308744-46308766 TTCCTGAGGCCCTCTCCGGGAGG + Intergenic
1113909262 13:113834491-113834513 TTCCGGGGGCCCTCGCCGGTGGG - Intronic
1116231968 14:42229238-42229260 TTCTGGGGGCCCAAGCCAGTGGG + Intergenic
1122392679 14:101400916-101400938 TTCCGGAGGCTCTTGCTGGTTGG - Intergenic
1129739968 15:77985388-77985410 TTCCTGGAGCCCTCGTGGGTGGG + Intronic
1129817292 15:78565893-78565915 TTCCGGCGGCCGTCGCCTGGCGG - Intronic
1130632579 15:85583543-85583565 TTTTGGGGGCCCTGGCAGGTTGG + Intronic
1144495525 17:15742664-15742686 TTCCCTGGGCCCTCGCAAGTCGG - Intronic
1146183248 17:30710004-30710026 CTCCCGGGCCCCTCGCCAGTGGG - Intergenic
1160801624 19:972998-973020 GTCAGGGGCCCCTGGCCGGTGGG - Exonic
1161398307 19:4056398-4056420 TCCCGGGGGCCCTCCTCGGAGGG - Intronic
1163648813 19:18505367-18505389 TGCCGGGTGCCCTTGCCCGTGGG - Intronic
1165445550 19:35855227-35855249 TCCTGGGGGCCCTCGCCAGATGG + Intronic
1166781289 19:45344966-45344988 TTCTGGGGGCCCTGGCCCCTCGG + Intronic
1168538456 19:57191444-57191466 TTCCGACGGCTCACGCCGGTGGG + Intergenic
934954786 2:98608519-98608541 TTCCGGCGGGCCGCGGCGGTAGG + Intergenic
935060334 2:99601625-99601647 TTCCCGGGGGCCTCGCGGGCTGG - Intronic
947791809 2:232872994-232873016 CTCCTGGGGCCCTGGCCGCTTGG + Intronic
948461280 2:238131073-238131095 AGCCGGGGGCCCTCGCTGGGCGG - Exonic
948487364 2:238289227-238289249 TTCCCGCGGCCCTGGCCGCTGGG - Intronic
1172759545 20:37312397-37312419 TTCCTGGGGCCCTCAGGGGTAGG - Intronic
1179891846 21:44339210-44339232 GGCCGGGGGCGCCCGCCGGTCGG - Exonic
1181440401 22:22932613-22932635 TTCCGGGGTCCCTACCCAGTGGG + Intergenic
1184036566 22:41920815-41920837 TCCCCAGGGCCCTGGCCGGTGGG - Intergenic
1184438921 22:44497220-44497242 TTCCGGGGACCCAGGCCGGTTGG - Exonic
951237399 3:20251704-20251726 TTCCTGGGGCCCTCACCAGAAGG - Intergenic
964451523 3:156817126-156817148 TTCAGGCGGCCGTCGCCGGGCGG + Intergenic
968872008 4:3247008-3247030 TGCCGGGGGCCCCCACCGGACGG - Intronic
976246753 4:83012664-83012686 CTCCGGGAGCCCGGGCCGGTGGG - Intronic
1011129440 6:84038159-84038181 TGCCAGGGGCCCTCGCCCTTAGG - Intronic
1026853649 7:73739312-73739334 TGCCGGGGGCCCGGGCAGGTTGG + Intergenic
1032083103 7:128869807-128869829 TTCCGGGTGCCCTCCGGGGTCGG - Intronic