ID: 1113909265

View in Genome Browser
Species Human (GRCh38)
Location 13:113834503-113834525
Sequence GGCCCCCGGAACCACCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909253_1113909265 23 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909255_1113909265 -1 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909259_1113909265 -9 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909257_1113909265 -2 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1113909261_1113909265 -10 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909265 Original CRISPR GGCCCCCGGAACCACCGTGA AGG Intronic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG + Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084969510 11:72763021-72763043 GGACACCGGAACCAGCTTGAAGG + Intronic
1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG + Intergenic
1104919666 12:132283917-132283939 GACCCCCGAGACCACCTTGACGG - Intronic
1107994255 13:45845429-45845451 GGCCATCTGAAACACCGTGATGG - Intronic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1119852951 14:77879077-77879099 GGCTCCCTCAGCCACCGTGAAGG + Intronic
1122004246 14:98688827-98688849 GGCCTTGGGAACCACCATGATGG + Intergenic
1127282624 15:57504873-57504895 GGCCCCATGAATCACTGTGAGGG - Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160789690 19:917777-917799 GGCCCTCGGAGCCCCCGGGACGG - Intronic
1161579955 19:5075266-5075288 GGCCCCCGGAACCAACACCAGGG - Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG + Intergenic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
925246737 2:2390212-2390234 GGCCTCAGGAAACACAGTGATGG + Intergenic
926395936 2:12442315-12442337 GGCCCCAGGAGCCACTGAGATGG + Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1174507002 20:51023294-51023316 GGCCCCCGGATCCAAGGTGCGGG - Intergenic
1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG + Intergenic
1176231307 20:64034403-64034425 GGTCCCCAGAACCACAGGGAAGG - Intronic
1179564157 21:42235902-42235924 GGCCCCCTGAACCATGGGGATGG - Intronic
1184737853 22:46409671-46409693 TGTGCCCGGGACCACCGTGAGGG - Intronic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
985797209 5:1972141-1972163 GGCCCCCGGAGCCCCCGAGCAGG - Intergenic
997732649 5:136192443-136192465 GGCCCCAGGAGCCACGGTCAAGG - Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG + Intergenic
1007239343 6:40413880-40413902 GGCACTCAGAACCACCATGAGGG - Intronic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1027507832 7:79040272-79040294 GGCCTCCGGAAACACAGTCATGG - Intronic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1035563674 8:627629-627651 GGCACCCCGGACCTCCGTGAAGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040567875 8:48582863-48582885 GGCCCCCAAAACCACCGTCCTGG - Intergenic
1049229943 8:141476788-141476810 GGCCCCGGGAGCCACGGGGAAGG - Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1062467066 9:136686224-136686246 TGCCCCTGGAACCACGGGGAAGG + Intronic
1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG + Intronic