ID: 1113909266

View in Genome Browser
Species Human (GRCh38)
Location 13:113834504-113834526
Sequence GCCCCCGGAACCACCGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909261_1113909266 -9 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909255_1113909266 0 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909253_1113909266 24 Left 1113909253 13:113834457-113834479 CCAGGTCTTCACGGAAGTGTTTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909257_1113909266 -1 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909259_1113909266 -8 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43
1113909262_1113909266 -10 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909266 Original CRISPR GCCCCCGGAACCACCGTGAA GGG Intronic
900547882 1:3238630-3238652 GCTCCCGCAAGAACCGTGAAAGG - Intronic
900673398 1:3869617-3869639 GCCTCCGCACCCACCGTGGAGGG - Exonic
901443515 1:9293250-9293272 GCCCCCGGAGCCACCGCGGGAGG - Intronic
912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG + Intergenic
922700534 1:227757070-227757092 GCCCCTGGAGCCACAGAGAAAGG - Intronic
1063161050 10:3419116-3419138 GCCCCCAGAACCCACGTCAAGGG + Intergenic
1065534961 10:26707647-26707669 GCCCACGGAACCCCAGGGAATGG - Intronic
1084969511 11:72763022-72763044 GACACCGGAACCAGCTTGAAGGG + Intronic
1087009888 11:93503224-93503246 GCCCCCCCAACCATGGTGAAAGG + Intronic
1092427568 12:8386890-8386912 GCCCCCACCACCACCATGAATGG + Intergenic
1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG + Intronic
1096477332 12:51916212-51916234 GCCCGCCGGACCATCGTGAATGG + Exonic
1099574277 12:84361681-84361703 GCCCAGGGGACCACCGTGACGGG + Intergenic
1102445500 12:112999147-112999169 GCCCCCGGCACCTGCCTGAACGG - Intronic
1102866810 12:116381345-116381367 GCACCGGGAACCTCCGTGGAAGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1118117915 14:62802426-62802448 GTCCCCGGGAGCACAGTGAATGG + Exonic
1128982498 15:72197686-72197708 GCCTCCGGAACCCCCGAGACCGG + Intronic
1136500477 16:30667565-30667587 GCCCCGGGAGCTGCCGTGAAAGG - Exonic
1141732109 16:85829786-85829808 GCCCCGGGGGCCACCGTGCAGGG + Intergenic
1142599654 17:1047402-1047424 GCCCTCAGAGCCACCGTGGATGG - Intronic
1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG + Intergenic
1157815580 18:50727543-50727565 GCCGCAGGAACCACAGTCAAGGG - Intronic
1165924707 19:39320104-39320126 CCCCCCGCAACCACCGGGAAGGG + Intergenic
1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG + Exonic
927519799 2:23691868-23691890 GCCCCCGGGCTCACCGAGAAAGG - Exonic
947762973 2:232617158-232617180 GAACCCTGAACCACCGCGAATGG - Intronic
1176231306 20:64034402-64034424 GTCCCCAGAACCACAGGGAAGGG - Intronic
1179579962 21:42336426-42336448 TCCCCGGGATCCACCTTGAAGGG + Intergenic
1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG + Intronic
1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG + Intergenic
1184737852 22:46409670-46409692 GTGCCCGGGACCACCGTGAGGGG - Intronic
950512310 3:13438322-13438344 GTCCCGGGAACTGCCGTGAAGGG + Intergenic
954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG + Intronic
954421635 3:50421979-50422001 CCCCCAGGAACCAACGTGGATGG - Intronic
969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG + Intronic
972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG + Intronic
1006367074 6:33621975-33621997 GCCCCCGGGACCACCTGCAAAGG - Intronic
1011945071 6:92890664-92890686 GACCCTGGAACCACTGTGACTGG + Intergenic
1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG + Intronic
1038612514 8:29069294-29069316 GCCCCCAGGCCCACCGTGCATGG - Exonic
1042007817 8:64201894-64201916 GCCACCTGGACCACCATGAATGG + Intergenic
1060389626 9:123267699-123267721 GCCACCGGGACGCCCGTGAAGGG - Intronic
1061499666 9:130994600-130994622 GGCCCCTGCACCACCGAGAAGGG + Intergenic
1061714232 9:132508996-132509018 GCCACTGGCACCAACGTGAACGG - Intronic
1062467067 9:136686225-136686247 GCCCCTGGAACCACGGGGAAGGG + Intronic