ID: 1113909272

View in Genome Browser
Species Human (GRCh38)
Location 13:113834512-113834534
Sequence AACCACCGTGAAGGGCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909262_1113909272 -2 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909261_1113909272 -1 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909264_1113909272 -6 Left 1113909264 13:113834495-113834517 CCGGCGAGGGCCCCCGGAACCAC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909259_1113909272 0 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909255_1113909272 8 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909263_1113909272 -3 Left 1113909263 13:113834492-113834514 CCACCGGCGAGGGCCCCCGGAAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113909257_1113909272 7 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909272 Original CRISPR AACCACCGTGAAGGGCCCGC GGG Intronic
907389671 1:54150121-54150143 CACCACAGTGACTGGCCCGCAGG + Intronic
915512010 1:156391576-156391598 AACCACTGTGAAACCCCCGCAGG - Intergenic
1063614456 10:7589933-7589955 ACTCACCCTGAAGGGCCAGCGGG - Intronic
1063739718 10:8804638-8804660 AACCACCGTGCATGGCCAGGAGG + Intergenic
1067980213 10:51075370-51075392 TACCAGCGTGAAGCGCCAGCAGG - Intronic
1071501213 10:86205579-86205601 AACCTGGGTGAAGGGCACGCTGG + Intronic
1072579384 10:96726642-96726664 AACCACCGTGCCCGGCCCTCAGG - Intergenic
1076644960 10:131946936-131946958 AACCACCAAGACGGTCCCGCCGG - Intronic
1083431695 11:62616659-62616681 ATCCACAGGGAAGGGCCTGCTGG + Exonic
1083883005 11:65557765-65557787 GACCACCTTGAAGCGCTCGCGGG + Exonic
1084485427 11:69445127-69445149 AGCCAACGTGAGGGGCCCACAGG - Intergenic
1100871887 12:98918184-98918206 AACCTCCGTGAAGGGCCTGAGGG - Intronic
1104991470 12:132626081-132626103 CTCCACAGTGAAGGGCCCGCTGG + Intronic
1113909272 13:113834512-113834534 AACCACCGTGAAGGGCCCGCGGG + Intronic
1122790457 14:104182187-104182209 GACCACAGTGCAGGGCCGGCGGG - Intergenic
1125429418 15:39580736-39580758 GACCACCTAGGAGGGCCCGCGGG - Intergenic
1128541433 15:68537261-68537283 AACCACCCTGAAGGGAACTCTGG - Intergenic
1132542665 16:518433-518455 AACCACCGTGGATGGCCGGCGGG + Intronic
1133203288 16:4217844-4217866 GAACAGCGTGAAGGGCCAGCTGG - Intronic
1139950316 16:70665149-70665171 AGCCACAGTGACGGGCCCCCGGG - Intronic
1148336467 17:46845250-46845272 AACCACCGTGAAGTCCCCTATGG - Intronic
1152004875 17:77674147-77674169 ACCCAAAGTGAAGGGCCCCCGGG + Intergenic
1152494253 17:80659930-80659952 AACCACCGTGCCTGGCCTGCAGG + Intronic
925888305 2:8412195-8412217 AAGCACCGTGAAGGCACCGAGGG - Intergenic
1174139215 20:48400930-48400952 AAGCACCTGGAAGGGCCCTCAGG - Intergenic
1176248014 20:64106541-64106563 TACCAGCGTGAAGAGCCCGTCGG + Exonic
964791011 3:160453131-160453153 ATCCACAGGGAAGGGCCCGTTGG - Intronic
968524143 4:1047367-1047389 CACCACCGTGACAGGTCCGCAGG + Intergenic
1006906269 6:37535783-37535805 AACCACCTTCCAGGGCCCCCAGG - Intergenic
1010214497 6:73389433-73389455 AACGAACTTGAAAGGCCCGCAGG + Intronic
1013355364 6:109341554-109341576 AACCATCCTGAAGGACCCGACGG + Intergenic
1018631668 6:165827118-165827140 GACCACGGCGGAGGGCCCGCAGG - Intronic
1023703023 7:42911673-42911695 GCCCACCGAGAAGGCCCCGCCGG - Intronic
1027049486 7:75012930-75012952 AACCACCGTGCACAGCCCACTGG + Intronic
1028673064 7:93426562-93426584 AACCACCGTGAAGCGCCAATGGG - Exonic
1030348101 7:108455835-108455857 AGCCGCCGTGCCGGGCCCGCAGG + Intronic
1043516341 8:80998411-80998433 AACCACCATGACCGGCCAGCAGG + Intronic
1049008824 8:139874035-139874057 AACCACCCTGAAGGCCAGGCTGG + Intronic
1049796253 8:144498540-144498562 CACCACCATGAAGGGCCTGCAGG + Intronic
1053409064 9:37903983-37904005 AAACGCGCTGAAGGGCCCGCTGG - Exonic
1188559502 X:31451565-31451587 AGCCACCGTGCCGGGCCTGCAGG + Intronic
1191252441 X:58266011-58266033 AGCCACTGTGCAGGGCCCGCGGG - Intergenic
1197250250 X:124208795-124208817 AACCACCGTCAAGTTCCAGCAGG + Intronic
1198095763 X:133378280-133378302 AACCACCGTGCCCGGCCCCCGGG - Intronic