ID: 1113909273

View in Genome Browser
Species Human (GRCh38)
Location 13:113834513-113834535
Sequence ACCACCGTGAAGGGCCCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909261_1113909273 0 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909262_1113909273 -1 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909257_1113909273 8 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909264_1113909273 -5 Left 1113909264 13:113834495-113834517 CCGGCGAGGGCCCCCGGAACCAC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909255_1113909273 9 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909263_1113909273 -2 Left 1113909263 13:113834492-113834514 CCACCGGCGAGGGCCCCCGGAAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1113909259_1113909273 1 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909273 Original CRISPR ACCACCGTGAAGGGCCCGCG GGG Intronic
907389672 1:54150122-54150144 ACCACAGTGACTGGCCCGCAGGG + Intronic
911027112 1:93447915-93447937 ACCAGCGAGAGGGGCCAGCGAGG + Intergenic
918001687 1:180502808-180502830 GCCACCGGGATGGGCCCCCGGGG + Exonic
920090508 1:203449659-203449681 ACCAACCTGAAGGGACCACGGGG - Intergenic
922287604 1:224183483-224183505 ACGACCGCGCAGGGCCCGCGAGG - Intronic
1064012001 10:11742759-11742781 ACCAACGCGAGGAGCCCGCGCGG - Intronic
1076536277 10:131179614-131179636 ACCACCATGGAGGGCTGGCGGGG + Intronic
1100871886 12:98918183-98918205 ACCTCCGTGAAGGGCCTGAGGGG - Intronic
1104902764 12:132198116-132198138 ACCGCCGGGCAGGGCCCACGTGG + Intronic
1104953203 12:132451568-132451590 ACCACCCTGCAGGACTCGCGTGG - Intergenic
1105067158 12:133210626-133210648 ATCACTGTGAAGTGCCCTCGGGG + Intergenic
1105756146 13:23466328-23466350 ACGATCGAGCAGGGCCCGCGGGG + Intergenic
1113909273 13:113834513-113834535 ACCACCGTGAAGGGCCCGCGGGG + Intronic
1125429417 15:39580735-39580757 ACCACCTAGGAGGGCCCGCGGGG - Intergenic
1132542666 16:518434-518456 ACCACCGTGGATGGCCGGCGGGG + Intronic
1139471203 16:67179067-67179089 TCCACCCTGGAGGGCCAGCGTGG + Intronic
1141464989 16:84199396-84199418 ACCAGCAGGAAGGGTCCGCGGGG + Intergenic
1141878617 16:86843065-86843087 ACCAACGCGAAGGGCACGCCTGG - Intergenic
1145817236 17:27804362-27804384 AGCACCTTGAAGGGCAGGCGGGG + Intronic
1154028047 18:10725801-10725823 TCCACCCTGGAGGGCCCGCGTGG - Intronic
1156541310 18:37913703-37913725 ACCACAGTGATGGGCCTGGGAGG - Intergenic
1161925110 19:7294056-7294078 AGCCCCGGGAAGGGCGCGCGCGG + Intergenic
1161953805 19:7482085-7482107 ACCACCGAGAAGAGTCCACGTGG + Exonic
1168355889 19:55699451-55699473 ACCACAGTGAAGGGCCTGGCAGG - Intronic
935731748 2:106070055-106070077 ACCACACTGAAGGGCCAGGGAGG - Intronic
947998615 2:234548893-234548915 ACCAGCGGGGAGGGCCCGGGAGG + Intergenic
948580627 2:238985535-238985557 CCCTCCCTGAGGGGCCCGCGCGG - Intergenic
948692891 2:239718008-239718030 ACCACCGGCAAGGGCGCGAGGGG + Intergenic
1180009605 21:45040689-45040711 ACCACCTTGAAGGGACCCTGGGG - Intergenic
971208785 4:24596025-24596047 ACTACCGTGGAGGGCCCAAGTGG - Intergenic
996694906 5:126383533-126383555 ACCACAGTGAAAGGCCAGCAAGG - Intronic
998283485 5:140835554-140835576 ACCAACTTGAAGGGAACGCGGGG - Exonic
1001434500 5:171688736-171688758 ACCCCCGTGAAGGCCCTGGGAGG + Intergenic
1006236459 6:32637501-32637523 ACCACCGTGATGAGCCCCTGTGG + Exonic
1010775424 6:79879345-79879367 ACCACCCTGAAGAGCCAGCCTGG + Intergenic
1034760747 7:153669520-153669542 ACCACTGTGCAAGGCCCTCGGGG - Intergenic
1038577606 8:28718034-28718056 ACCACCGTGAACTGCTCTCGGGG - Exonic
1049347598 8:142147048-142147070 GCCACTGTGATGGGCCCGCCTGG - Intergenic
1060730534 9:126034120-126034142 CCCACCCTGGAGGGCCCTCGGGG + Intergenic
1191252440 X:58266010-58266032 GCCACTGTGCAGGGCCCGCGGGG - Intergenic