ID: 1113909276

View in Genome Browser
Species Human (GRCh38)
Location 13:113834518-113834540
Sequence CGTGAAGGGCCCGCGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 206}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909267_1113909276 -10 Left 1113909267 13:113834505-113834527 CCCCCGGAACCACCGTGAAGGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909255_1113909276 14 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909263_1113909276 3 Left 1113909263 13:113834492-113834514 CCACCGGCGAGGGCCCCCGGAAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909257_1113909276 13 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909264_1113909276 0 Left 1113909264 13:113834495-113834517 CCGGCGAGGGCCCCCGGAACCAC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909261_1113909276 5 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909259_1113909276 6 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206
1113909262_1113909276 4 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909276 Original CRISPR CGTGAAGGGCCCGCGGGGCC AGG Intronic
900382569 1:2392063-2392085 CGGGGAGGGCCGTCGGGGCCCGG + Intronic
901222354 1:7590434-7590456 CCTGAAGAGCCAGCGGGGCCTGG - Intronic
901234575 1:7661119-7661141 ACTGAAGGGCCCACGTGGCCTGG - Intronic
902385511 1:16073440-16073462 CATCACGGGGCCGCGGGGCCGGG + Exonic
902799217 1:18819111-18819133 CGTTTAGGGCACGGGGGGCCTGG - Intergenic
903847253 1:26285720-26285742 CGTGGAGGGCAGGCTGGGCCTGG + Intronic
904774919 1:32900867-32900889 CCAGAAGGGACCCCGGGGCCAGG - Intronic
905169103 1:36099178-36099200 CCTGAGGGGCCCGGGAGGCCAGG + Exonic
905846921 1:41241674-41241696 CGTGTCTGGCCGGCGGGGCCGGG - Intronic
906263156 1:44407912-44407934 CGCGCGGGGCCCGCGGGGCAGGG - Intronic
907308326 1:53525741-53525763 GGTGTAGGGCCTGCGGTGCCGGG - Intronic
907440393 1:54474985-54475007 CGGAAGGGGCCCGCGGGGTCGGG + Intergenic
909931634 1:81504575-81504597 AGGGAAGGGCCAGAGGGGCCGGG - Intronic
910771526 1:90836264-90836286 CCTGAACGCCCAGCGGGGCCGGG + Intergenic
915341434 1:155178859-155178881 CGGGCAGGGCCCCCGGGGCAGGG - Intronic
916127961 1:161588322-161588344 GGTGAAGGGCGCTCTGGGCCTGG + Intronic
916137879 1:161670152-161670174 GGTGAAGGGCGCTCTGGGCCTGG + Intronic
916738725 1:167630236-167630258 CGCGCAGGGCCCCCGCGGCCGGG + Exonic
920090504 1:203449654-203449676 CCTGAAGGGACCACGGGGCAGGG - Intergenic
922440535 1:225652664-225652686 GGTGAGGGGCGCGCGGGGCGGGG - Exonic
924775213 1:247111477-247111499 CGCGAAGGGCCCGGGGCGCCGGG + Exonic
1062843856 10:689897-689919 CGTCACGGGGCCGCGGGGGCAGG + Intergenic
1063995052 10:11611395-11611417 CGTGAGGGGCCGGCGGCGGCGGG - Intronic
1064011999 10:11742754-11742776 CGCGAGGAGCCCGCGCGGCCCGG - Intronic
1064032848 10:11894097-11894119 CTGGAAGGGGCCACGGGGCCTGG + Intergenic
1065883694 10:30059116-30059138 CGCGGAGGGCCTGGGGGGCCGGG - Intronic
1066697911 10:38094837-38094859 GGGGAAGCGCCCGCGGGGCGGGG + Intronic
1066994596 10:42552352-42552374 CGGGAAGCACCCGCGGGGCGGGG - Intergenic
1072788607 10:98301725-98301747 TGGGAAGAGCCAGCGGGGCCAGG - Intergenic
1075616107 10:123891805-123891827 TGTGACCGGCCCGCGGGGCTGGG + Exonic
1076392067 10:130110685-130110707 CGTGGTGAGCCCCCGGGGCCTGG - Intergenic
1076885806 10:133261884-133261906 CGTGGAGGCCGCGCGGGGCCGGG + Intergenic
1077100413 11:819941-819963 CGGGAAGGCCGTGCGGGGCCGGG + Intronic
1077136219 11:1000480-1000502 GGTGGGGGGCCCGCGGGGGCAGG - Exonic
1077365226 11:2158881-2158903 CCAGAAGGGCCCACGGGCCCTGG - Intronic
1077505884 11:2929783-2929805 CGGGAAGCACCCGCGGGCCCGGG + Intergenic
1077518382 11:3016130-3016152 CTTGAAAGGCCAGCAGGGCCTGG - Intronic
1079090568 11:17477174-17477196 AGAGAAGGGCCCGCAAGGCCTGG + Intergenic
1081709214 11:45206207-45206229 CGGGAAGGGCCAGCGGGGGTGGG - Intronic
1081989866 11:47332050-47332072 GGTGAGGAGCCCTCGGGGCCAGG - Exonic
1083448506 11:62726983-62727005 CTTGCAGGCCCCGCCGGGCCCGG + Exonic
1083589784 11:63886942-63886964 AGTGAAGGGCCGGAGGGCCCGGG + Intronic
1084128817 11:67118585-67118607 CGGGCTGGGCCCGCGGGACCTGG - Intergenic
1084463635 11:69309687-69309709 CGTTAGGGGCCAGCTGGGCCTGG - Intronic
1084588875 11:70078869-70078891 CGGGAAGGGCGCGCCGGCCCTGG + Intronic
1084649140 11:70478371-70478393 TGTCAAGGGCCTGCTGGGCCTGG + Intronic
1084973071 11:72781801-72781823 CGGGAGGGGCGCGCGGGGCTGGG - Intronic
1085050302 11:73376810-73376832 TGTGAGGGGCCGGCGGGGCCCGG + Intronic
1089533794 11:119148992-119149014 CTTAAAGGGCCCGCGCCGCCCGG - Exonic
1092615632 12:10213249-10213271 GGGGAAGGGCCCGCGGGGGCGGG + Intronic
1094807638 12:34107887-34107909 GGGGAAGCGCCCGCGGGGTCCGG + Intergenic
1095440819 12:42237834-42237856 CGCCGAGGGCCCGCGGGGCGGGG - Intronic
1096154829 12:49336197-49336219 CCGGGAGGGCCCGGGGGGCCTGG + Exonic
1096495547 12:52037422-52037444 CGAGCGGAGCCCGCGGGGCCAGG + Intronic
1101907481 12:108838518-108838540 TGTGAAGGGCACGCGAAGCCAGG + Intronic
1102096721 12:110247006-110247028 GGTGAAGGGGCCAGGGGGCCAGG + Intergenic
1102278416 12:111599606-111599628 CGTGAGGTGGCCCCGGGGCCGGG + Exonic
1102825772 12:115946861-115946883 CGGGAAAGGCCCGTGGGCCCCGG - Intergenic
1104372217 12:128234073-128234095 CGTGAAGGGCCCTCGTGACTGGG + Intergenic
1104633619 12:130424649-130424671 CCTGTAGGGCCTGCCGGGCCTGG + Intronic
1104900952 12:132189286-132189308 TGTGAAGGGCACACGGAGCCGGG + Intergenic
1104941357 12:132397084-132397106 GGTGAAAGGCCAGGGGGGCCAGG - Intergenic
1108478396 13:50843314-50843336 GGTGCAGGGCCCGCGGTCCCGGG + Exonic
1110484047 13:76017193-76017215 AGTGAAGGGCCAGCGTGGCTGGG - Intergenic
1110860636 13:80341513-80341535 CGCGGGGCGCCCGCGGGGCCGGG + Intergenic
1113894455 13:113754862-113754884 CAGGAAGGGCCCGAGCGGCCTGG + Intergenic
1113909276 13:113834518-113834540 CGTGAAGGGCCCGCGGGGCCAGG + Intronic
1113947110 13:114050581-114050603 GGTGAGAGGCCCTCGGGGCCGGG - Intronic
1119709648 14:76812595-76812617 CAGGAGGGGCCCGCGGGGCAGGG + Intronic
1119808669 14:77498891-77498913 CCTGAGGGGCGCGCGGGGCACGG + Intergenic
1121444450 14:93969748-93969770 CCTGAAGGCCCTGCGGGGCCAGG - Intronic
1122515375 14:102304862-102304884 CTTGAGGGGCCTGTGGGGCCGGG - Intronic
1202849670 14_GL000225v1_random:8957-8979 CGTGCAGGGCACGTGGGGCGCGG - Intergenic
1125676063 15:41503176-41503198 GGTGAGCGGCCCGCGGGGACAGG - Exonic
1126061861 15:44790543-44790565 CGTGAATGGCACCAGGGGCCAGG - Intergenic
1126557380 15:50004236-50004258 AGGGAAGGCCCAGCGGGGCCGGG + Intronic
1127387087 15:58475377-58475399 GGTGAAGGGCCTGGGTGGCCGGG - Intronic
1127977567 15:64009449-64009471 GGTGAAAGGCCCCTGGGGCCTGG - Intronic
1128635307 15:69298941-69298963 GGTGCAGGGCCCGCGAGTCCGGG + Exonic
1129295294 15:74596880-74596902 AGGGAAGGGCCAGAGGGGCCGGG - Exonic
1132320031 15:100919137-100919159 CCGGAAGGGCCCGCGGACCCCGG + Intergenic
1132477556 16:148857-148879 CGTGAAGGGCTCTCAGTGCCTGG - Intergenic
1132481053 16:166255-166277 CGTGAAGAGCCTGCAGGACCAGG - Exonic
1132577536 16:670912-670934 CCTCCAGGGCCTGCGGGGCCAGG - Exonic
1132698048 16:1210645-1210667 GGTGAAGGTACCGCGGGGCCCGG + Exonic
1132724590 16:1333379-1333401 CGGGGAGGGCGCGCGCGGCCAGG + Intergenic
1132878084 16:2149057-2149079 GGTGCAGGGCCCGCGGCCCCAGG + Intronic
1132891793 16:2208338-2208360 CGTGCAGGGCCTGCTGGCCCGGG + Intronic
1132903754 16:2271870-2271892 CCTGATGGGCCCTCGAGGCCAGG - Intergenic
1133788246 16:8989479-8989501 AGAGAAGGGGCCGAGGGGCCAGG - Intergenic
1136299100 16:29321262-29321284 TGTGAAGGGCGCACAGGGCCAGG - Intergenic
1141430398 16:83968155-83968177 CGTGACGGGGCCGCGGGGCGTGG + Intergenic
1141464992 16:84199401-84199423 CAGGAAGGGTCCGCGGGGCCGGG + Intergenic
1142005338 16:87687140-87687162 CGAGAAGGCCCCGGGGTGCCTGG - Intronic
1142060788 16:88027817-88027839 TGTGAAGGGCGCACGGGGCCAGG - Intronic
1142133156 16:88440035-88440057 CGAGGAGGGCCCGCGGGAGCTGG - Exonic
1142265706 16:89063150-89063172 AGTGAAGTGCCGGCGGGGACGGG - Intergenic
1142399255 16:89850683-89850705 CGTGGAGGGTCCGGGAGGCCAGG + Intronic
1142850395 17:2701829-2701851 GGAGAAGGGGCCGAGGGGCCTGG - Intronic
1143011026 17:3866246-3866268 CATGAAGGGTCCGCAAGGCCAGG + Intronic
1143057506 17:4173315-4173337 CGAGTAGGCCCCGCGGCGCCTGG - Intronic
1143524029 17:7462277-7462299 AGTGAAGGGCCAGTGGGGGCTGG - Exonic
1146393642 17:32444637-32444659 CGAGCTGGGCCGGCGGGGCCGGG - Intronic
1148748391 17:49931062-49931084 TGCGAAGGGCACGCGGGGCCAGG + Intergenic
1151854366 17:76710705-76710727 CCTGGAGAGCCCGCGGGGCTGGG - Exonic
1152408185 17:80109131-80109153 AGTGGAGGGCCCGGTGGGCCTGG + Intergenic
1152645204 17:81465534-81465556 CCTGAAGCTCCCGTGGGGCCAGG - Exonic
1152987697 18:334960-334982 CCTGGTGGGCCCGGGGGGCCTGG + Exonic
1154241699 18:12658409-12658431 CGTGGGGGACACGCGGGGCCGGG + Intronic
1155972044 18:32092258-32092280 CGTGGAGGGGCCGGGGTGCCGGG + Intronic
1159697515 18:71578978-71579000 AGTGAAGGGCCCTCGTGACCGGG - Intergenic
1160453268 18:78979519-78979541 CGCGGAGGGGACGCGGGGCCGGG + Intergenic
1160725492 19:616298-616320 CGTGTGGAGGCCGCGGGGCCGGG - Exonic
1160871204 19:1278721-1278743 AGTGAAGGGCCCGCCCTGCCGGG - Intronic
1160887168 19:1355295-1355317 AGTGAGGGGCCCACGGCGCCAGG - Intronic
1161007800 19:1945101-1945123 CGAGAAGGGGCCGCGGAGCCTGG - Intronic
1161059859 19:2209524-2209546 CGTGCAGGGCGCGGGGGCCCAGG - Intronic
1161169844 19:2807260-2807282 GGTGAGGGGGCGGCGGGGCCGGG - Intronic
1161280177 19:3441666-3441688 AGGGAAGGGCCAGAGGGGCCGGG + Intronic
1161620102 19:5293162-5293184 TGTGGAGGCCTCGCGGGGCCTGG - Intronic
1162228597 19:9245824-9245846 CGTGAAGGGCCCTCGTGACTGGG + Intergenic
1162995683 19:14333662-14333684 CGGGAAGGGCCCGGGCTGCCGGG - Intergenic
1163432670 19:17277574-17277596 TGTGAAGGCCCAGCAGGGCCTGG - Intronic
1163598237 19:18232893-18232915 GGGGAGGGGCGCGCGGGGCCTGG - Intronic
1163885031 19:19957918-19957940 CGTGAAGGGCCCTCGTGACTGGG + Intergenic
1164705141 19:30314178-30314200 AGTGAAGGGCCTGGGGGCCCCGG + Intronic
1165446007 19:35857017-35857039 CGTGAAGGGGGCTCCGGGCCAGG + Exonic
1165578019 19:36838336-36838358 CATCAAGGGACCGCAGGGCCGGG - Exonic
1165668610 19:37655543-37655565 CGGGAGGGGCGCGTGGGGCCGGG + Intronic
1168553280 19:57317627-57317649 CTTGAAGCGCCCGCGGGGGTGGG - Intergenic
925785923 2:7431351-7431373 CATGCAGGGCCCCCGCGGCCAGG - Intergenic
927673823 2:25090236-25090258 AGGGAGGGGCCCGGGGGGCCTGG - Intronic
927956772 2:27212312-27212334 CGGGGCGGGGCCGCGGGGCCGGG + Exonic
934971680 2:98769311-98769333 CCTGCAGGGCACCCGGGGCCTGG - Intergenic
936110355 2:109659722-109659744 TCTGAGGGGGCCGCGGGGCCGGG + Intergenic
941104874 2:161341085-161341107 CCTGGAGAGCCCGCGGGGCTGGG - Intronic
943639534 2:190343623-190343645 CGTGGGGGGCCCGCGCGTCCCGG + Exonic
948454180 2:238097128-238097150 CCTGGAGGGCCAGCGTGGCCGGG + Intronic
1168800855 20:642491-642513 CTGGAAGGGGCCGCGCGGCCTGG + Intergenic
1171492912 20:25533995-25534017 CTTGAAGGCACTGCGGGGCCAGG + Intronic
1174366626 20:50060548-50060570 TGTGCAGGGCCCGCGGGGTGTGG + Intergenic
1176111793 20:63414214-63414236 CGTGAGGGGCCGAGGGGGCCGGG + Intronic
1176305847 21:5122759-5122781 TGTGGAGGGCACGCGGGGCAGGG + Intronic
1177715983 21:24840376-24840398 AGTGCAGGGCCCGCTGAGCCTGG + Intergenic
1179851210 21:44139272-44139294 TGTGGAGGGCACGCGGGGCAGGG - Intronic
1180655752 22:17419161-17419183 CCTGAAGCCCCCGCGGGGTCAGG + Intronic
1181637562 22:24181422-24181444 AGTGCAGGGCGGGCGGGGCCAGG + Exonic
1183744544 22:39685325-39685347 GGTGGGGGGCCCACGGGGCCGGG + Intronic
1184550753 22:45203088-45203110 CATGAAGGGCCCCCAGGGCAAGG - Exonic
1184890432 22:47375774-47375796 ACTGAAGTGCCCGAGGGGCCGGG + Intergenic
1185278752 22:49961036-49961058 CGCGCGGGGCCGGCGGGGCCGGG + Intronic
1185345056 22:50307405-50307427 CGCGGAGGGCTCCCGGGGCCTGG - Intronic
1185398322 22:50603726-50603748 GGTGGTGGGCCCGCGGGGCGCGG + Intronic
950193304 3:10992665-10992687 AGGGCAGGGCCCGCGGCGCCCGG - Intergenic
950703585 3:14766716-14766738 CGTGAAGGGCCCACCAGGCAGGG + Intronic
953165073 3:40457557-40457579 CGTGGAGGGCCCGGCAGGCCTGG + Intronic
953771193 3:45779806-45779828 CGTAAGGGGCCCGTGGAGCCCGG + Intronic
954133880 3:48573181-48573203 CCTGAAGGGCCGGGGGGTCCAGG + Exonic
954145486 3:48632328-48632350 CGTTCAAGGCCTGCGGGGCCAGG + Exonic
954432039 3:50475979-50476001 CCTGATGGGCCCGTGGGGGCAGG - Intronic
955996951 3:64687741-64687763 CGTGGAGAGCGCGCGGAGCCCGG + Exonic
961081793 3:124033820-124033842 CGGGCAGGGCGCGGGGGGCCAGG + Intergenic
962254305 3:133860014-133860036 CGTGAAGGGCCGGAGGGGCTCGG + Intronic
963028450 3:140942378-140942400 GGTTTTGGGCCCGCGGGGCCGGG + Intronic
963038540 3:141052013-141052035 GGTGAGGGGCGCGCGGGGGCCGG + Intronic
967858536 3:194135189-194135211 CTTAAAGGGCCCGCGGGCGCCGG + Intergenic
968196649 3:196712490-196712512 CGAGAGGGGCGCGCGGGGCCAGG - Exonic
968674579 4:1870911-1870933 CGTGAGAGGGGCGCGGGGCCTGG - Intergenic
968693654 4:2009466-2009488 GGTGCTGGGCCCGCGGGGGCGGG - Exonic
969465418 4:7353460-7353482 TGTGAAGGGTCTGCAGGGCCTGG + Intronic
971002108 4:22335193-22335215 CGTGAAGGGCCCTCGTGACTGGG - Intergenic
974069455 4:57110495-57110517 CGCGCAGGCCCCGCGGGGCCGGG - Intergenic
978503633 4:109434088-109434110 CGGGAAGGGCGTTCGGGGCCAGG + Intronic
983920101 4:173335081-173335103 CGGAAAGGGCGCGGGGGGCCGGG + Exonic
985371410 4:189289233-189289255 TCTGAAGGGCCCCCGGGGCCAGG + Intergenic
985537507 5:473399-473421 CGTGAGCGGCGCGCGGAGCCCGG + Intronic
985895641 5:2748876-2748898 CGAGGAGGGCGAGCGGGGCCTGG - Exonic
988734569 5:34007744-34007766 CGAGAGCAGCCCGCGGGGCCCGG + Intronic
997402243 5:133612121-133612143 GGGGAAGGGACCGCTGGGCCAGG - Intronic
997508448 5:134436811-134436833 TGTGAAAGGCCGGCGGGGCTGGG - Intergenic
998018824 5:138753340-138753362 CAGGAAGGGCGGGCGGGGCCGGG + Intronic
1002565521 5:180111221-180111243 CCTCAAGGACCCCCGGGGCCAGG - Intronic
1007397693 6:41586984-41587006 GGTGAGGGGCCCGAGGGGGCGGG - Intronic
1007435347 6:41806485-41806507 CGAGAAGAGCTCCCGGGGCCAGG - Exonic
1013372467 6:109482992-109483014 CCAGTCGGGCCCGCGGGGCCTGG - Intronic
1013803291 6:113970814-113970836 CGGGGTGGGCGCGCGGGGCCGGG - Intronic
1014079581 6:117270993-117271015 CGCGAAGGGTCCCCCGGGCCCGG - Exonic
1020032188 7:4940849-4940871 TGTGAACGGCCCCCTGGGCCTGG + Intronic
1020120630 7:5501233-5501255 CGGGAAGGACCTGCGGAGCCTGG - Exonic
1020147428 7:5655291-5655313 ACTGAAGGGCCCGAGGGTCCCGG + Intronic
1020162007 7:5780390-5780412 ACTGAAGGGCCCGAGGGTCCCGG + Intronic
1020210342 7:6154071-6154093 CGCGGAGGGCCCGCGGGACTCGG + Exonic
1021716661 7:23468645-23468667 CTCGAAGGGCCCCCGAGGCCCGG + Intronic
1024579991 7:50793488-50793510 CGGGGAGGGCGGGCGGGGCCGGG - Intergenic
1024676968 7:51645886-51645908 CTGGTGGGGCCCGCGGGGCCAGG - Intergenic
1024969382 7:55054502-55054524 CCTGGCGCGCCCGCGGGGCCTGG + Intronic
1027126914 7:75563114-75563136 TCTTAAGGGCCGGCGGGGCCTGG - Intronic
1027355310 7:77348498-77348520 TGTGAAGGGCAGGCCGGGCCTGG - Intronic
1028382228 7:90212021-90212043 CGTGGAGGGCGCGGGGGGCGCGG + Exonic
1029702419 7:102256108-102256130 CGTGCAGGGCCCGCGGGCTCTGG + Exonic
1030693135 7:112555483-112555505 CGTGAAGGGCCCTCATGGCTGGG + Intergenic
1032074587 7:128830393-128830415 CGGGAAGGGCGGGCTGGGCCGGG - Exonic
1032194202 7:129780260-129780282 CGCGAGGGGCGGGCGGGGCCCGG - Intergenic
1033159241 7:138981674-138981696 CGCGAGGGGCTCGGGGGGCCTGG + Intergenic
1034509196 7:151520262-151520284 CGTGAAGGGCGCGAGGCGCGTGG + Intergenic
1035530690 8:348570-348592 CGTGAAAGGCCCTTGTGGCCGGG - Intergenic
1048866488 8:138765265-138765287 CCTGGAGGGACTGCGGGGCCTGG + Intronic
1049197930 8:141325644-141325666 CGTGAAGGGCACACGGGGGCTGG + Intergenic
1049468389 8:142764155-142764177 CCTGAAGGGCACGGGGGCCCAGG - Intergenic
1049519888 8:143082674-143082696 CGGGATGGGCCAGCAGGGCCAGG - Exonic
1049716412 8:144095132-144095154 AGTGTTGGGCCCGCGGGGCGCGG + Exonic
1053129227 9:35605677-35605699 GGGGAGGGGCCCCCGGGGCCGGG + Exonic
1053409061 9:37903977-37903999 GCTGAAGGGCCCGCTGGGGCAGG - Exonic
1054340795 9:63859873-63859895 GGTGACGGTCCCGCGGGGGCGGG + Intergenic
1060418915 9:123453531-123453553 CGTGAAGGGCCCGGAATGCCAGG + Intronic
1060827280 9:126694422-126694444 CGTGAAGGGCCTGGGGAGTCGGG + Intronic
1060897222 9:127225464-127225486 TGTGAAGGGACAGCGGGGCGAGG + Intronic
1061092513 9:128434452-128434474 CGTGGAGGGGCTGCCGGGCCTGG + Exonic
1061840551 9:133356458-133356480 CCGGAAGCGCCCGCGGGGCCGGG - Exonic
1062502868 9:136858744-136858766 CGTGCTGGGCCCCGGGGGCCGGG + Exonic
1062504479 9:136866078-136866100 GGGGAAGGGCAGGCGGGGCCTGG - Intronic
1062591442 9:137276542-137276564 CGTGCTGGGGCCACGGGGCCTGG + Intergenic
1187888035 X:23907535-23907557 AGTGAATGAACCGCGGGGCCGGG + Intronic
1190108324 X:47574179-47574201 CGTGTGGGGCCGGCTGGGCCTGG + Exonic
1199881058 X:151974534-151974556 CGCGAAGGGCTCCCGGGTCCCGG + Intronic
1200039867 X:153357082-153357104 CGTGAAGGGCCCTCGTGACTGGG + Intronic