ID: 1113909277

View in Genome Browser
Species Human (GRCh38)
Location 13:113834519-113834541
Sequence GTGAAGGGCCCGCGGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909267_1113909277 -9 Left 1113909267 13:113834505-113834527 CCCCCGGAACCACCGTGAAGGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909257_1113909277 14 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909255_1113909277 15 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909268_1113909277 -10 Left 1113909268 13:113834506-113834528 CCCCGGAACCACCGTGAAGGGCC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909264_1113909277 1 Left 1113909264 13:113834495-113834517 CCGGCGAGGGCCCCCGGAACCAC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909262_1113909277 5 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909261_1113909277 6 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909263_1113909277 4 Left 1113909263 13:113834492-113834514 CCACCGGCGAGGGCCCCCGGAAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168
1113909259_1113909277 7 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909277 Original CRISPR GTGAAGGGCCCGCGGGGCCA GGG Intronic
900607646 1:3531038-3531060 GGGCAGGGCGGGCGGGGCCAGGG - Intronic
900688807 1:3966893-3966915 GGGCAGGGCCCACGGGGCAAGGG - Intergenic
901462940 1:9402344-9402366 GGGAAGGGCAGGGGGGGCCAAGG - Intergenic
902323200 1:15683196-15683218 GTGGAGGGCCAGGGGGCCCAGGG + Intergenic
902350217 1:15848359-15848381 TCGAAGAGCCCGCGGGGCCCCGG + Intronic
903142252 1:21345628-21345650 GTTAAGGGCCCGCGCGGGCGCGG - Intergenic
903211071 1:21818921-21818943 GTGGAGGGGAGGCGGGGCCAGGG - Intronic
903215221 1:21839892-21839914 CTGAGGGGCCCCTGGGGCCATGG + Exonic
904774627 1:32899201-32899223 GTGAGGGGCTGGCAGGGCCAGGG - Intronic
905169104 1:36099179-36099201 CTGAGGGGCCCGGGAGGCCAGGG + Exonic
906166310 1:43689037-43689059 GTGAGGGGCCTGTTGGGCCATGG - Exonic
906377040 1:45304109-45304131 CTGGAGGGCGCGCGGGGCCGCGG - Intronic
909931633 1:81504574-81504596 GGGAAGGGCCAGAGGGGCCGGGG - Intronic
912748683 1:112267662-112267684 GTGAAGGGCCAGTGGAGCCAAGG - Intergenic
913599588 1:120410392-120410414 GGGAAGGGTGCGCAGGGCCATGG - Intergenic
914087793 1:144469223-144469245 GGGAAGGGTGCGCAGGGCCATGG + Intergenic
914310819 1:146464981-146465003 GGGAAGGGTACGCAGGGCCATGG - Intergenic
914922963 1:151859932-151859954 TTGAAAGGCCCCCTGGGCCATGG + Intergenic
915328164 1:155092015-155092037 GTGACGGGGCTGGGGGGCCATGG + Intergenic
916127962 1:161588323-161588345 GTGAAGGGCGCTCTGGGCCTGGG + Intronic
916137880 1:161670153-161670175 GTGAAGGGCGCTCTGGGCCTGGG + Intronic
920145997 1:203861560-203861582 GTGAAGGTCACGCGGCGGCATGG - Intergenic
922440534 1:225652663-225652685 GTGAGGGGCGCGCGGGGCGGGGG - Intronic
1062834774 10:628544-628566 CTGATGGGCCTGCGGGGACATGG + Intronic
1062843857 10:689898-689920 GTCACGGGGCCGCGGGGGCAGGG + Intergenic
1062863360 10:828013-828035 GTGAAGGGCAGGTGGGGACAGGG - Intronic
1070593781 10:77818567-77818589 GAGAAGGGCCATCGGTGCCAAGG - Intronic
1073293469 10:102424722-102424744 CTGATGGGCCCGAGGGGCCCAGG + Exonic
1075712950 10:124540477-124540499 GTGAAGGGCGCTCGGGGAAAGGG - Intronic
1076776470 10:132700596-132700618 GGGAGGGGCCCGGGGAGCCATGG + Intronic
1076885807 10:133261885-133261907 GTGGAGGCCGCGCGGGGCCGGGG + Intergenic
1077136218 11:1000479-1000501 GTGGGGGGCCCGCGGGGGCAGGG - Exonic
1077218719 11:1405853-1405875 GTGTGGGGCCTGCGGGGCCAAGG - Intronic
1077417740 11:2432724-2432746 GAGTAGGGCCCGCTGGCCCAGGG + Intergenic
1077486758 11:2842271-2842293 GTGAAGGGCTCTGGGGGACAGGG + Intronic
1077543653 11:3159544-3159566 GTGAAGGGGCAGCGAGTCCATGG - Intronic
1078422064 11:11220738-11220760 GTGGAGGGGCAGCGGGACCAGGG - Intergenic
1080424302 11:32142278-32142300 GTGAAGGCCCCGCAGGCCTAAGG + Intergenic
1081989865 11:47332049-47332071 GTGAGGAGCCCTCGGGGCCAGGG - Intronic
1083260426 11:61519521-61519543 GTCAAGGGCCAGAGGGGACAGGG + Intronic
1083316416 11:61817156-61817178 GTGAATGGACTGAGGGGCCAGGG + Exonic
1086013400 11:82133603-82133625 TTGAAGGGCCCGCTGTGCTATGG + Intergenic
1092524038 12:9298655-9298677 GTGATGGGCCGGCCAGGCCAGGG - Intergenic
1092543232 12:9433159-9433181 GTGATGGGCCGGCCAGGCCAGGG + Intergenic
1092615633 12:10213250-10213272 GGGAAGGGCCCGCGGGGGCGGGG + Intronic
1094807639 12:34107888-34107910 GGGAAGCGCCCGCGGGGTCCGGG + Intergenic
1095944303 12:47745428-47745450 GGGCAGGGCCCCCTGGGCCAAGG - Intronic
1100871883 12:98918177-98918199 GTGAAGGGCCTGAGGGGCCATGG - Intronic
1102096722 12:110247007-110247029 GTGAAGGGGCCAGGGGGCCAGGG + Intergenic
1104941356 12:132397083-132397105 GTGAAAGGCCAGGGGGGCCAGGG - Intergenic
1108478397 13:50843315-50843337 GTGCAGGGCCCGCGGTCCCGGGG + Exonic
1110484046 13:76017192-76017214 GTGAAGGGCCAGCGTGGCTGGGG - Intergenic
1113723482 13:112579456-112579478 GCTGAGTGCCCGCGGGGCCACGG + Intronic
1113909277 13:113834519-113834541 GTGAAGGGCCCGCGGGGCCAGGG + Intronic
1122183510 14:99972019-99972041 GGGACGGGCGCGCCGGGCCAGGG - Intronic
1122658001 14:103274522-103274544 GGGAGGGGCCAGCTGGGCCAGGG - Intergenic
1128211966 15:65909281-65909303 GGCCAGGGCCAGCGGGGCCAGGG + Intronic
1128635308 15:69298942-69298964 GTGCAGGGCCCGCGAGTCCGGGG + Exonic
1129386946 15:75201668-75201690 GTGACGGGCCCGCCGGGCACTGG + Intronic
1129661494 15:77555402-77555424 GTGAAGGCCCAGCTGGGGCAGGG - Intergenic
1132149855 15:99451767-99451789 GAGAAGGGACCGGGTGGCCAAGG - Intergenic
1132577535 16:670911-670933 CTCCAGGGCCTGCGGGGCCAGGG - Exonic
1132633703 16:932308-932330 GAGATGGGCCTGCGAGGCCACGG - Intronic
1132698049 16:1210646-1210668 GTGAAGGTACCGCGGGGCCCGGG + Exonic
1132764379 16:1526846-1526868 GAGAAGGGGCCGTAGGGCCAGGG - Intronic
1132878085 16:2149058-2149080 GTGCAGGGCCCGCGGCCCCAGGG + Intronic
1138105575 16:54285762-54285784 GGTAAGAGCCCGCGGAGCCAGGG - Exonic
1141430399 16:83968156-83968178 GTGACGGGGCCGCGGGGCGTGGG + Intergenic
1141702340 16:85648308-85648330 GAGCAGGGCCCGTGGGGCAAAGG + Intronic
1142078279 16:88132939-88132961 GTGAAGGGCTCACAGAGCCAAGG + Intergenic
1142140176 16:88469238-88469260 CTGAAGTGCCGGCCGGGCCAGGG + Intronic
1142260261 16:89039534-89039556 TTCAGGGGCCCGTGGGGCCATGG + Intergenic
1142265705 16:89063149-89063171 GTGAAGTGCCGGCGGGGACGGGG - Intergenic
1142399256 16:89850684-89850706 GTGGAGGGTCCGGGAGGCCAGGG + Intronic
1142429761 16:90019601-90019623 GGGAGGGGTCCGCTGGGCCAGGG - Intronic
1142709618 17:1716006-1716028 GAGAAGGGGCGGCGGGGGCAGGG - Intergenic
1142850394 17:2701828-2701850 GAGAAGGGGCCGAGGGGCCTGGG - Intronic
1143431995 17:6894429-6894451 GTGCAGGGCCCGGGGACCCAAGG + Intronic
1144726675 17:17505840-17505862 GTGAAGGGCCTGCCGGGCAGCGG + Exonic
1144949396 17:18985787-18985809 GAGCAGGGCAGGCGGGGCCAGGG + Intronic
1146160131 17:30555170-30555192 GTGCAGAGCCAGCGTGGCCAAGG - Intergenic
1147970836 17:44218686-44218708 GTAAAGGGCGCGCGCGGCCACGG + Intronic
1148455211 17:47807783-47807805 GAGAAGGCCCTGCAGGGCCAGGG + Exonic
1149464283 17:56862657-56862679 GTGCAGGGCCCTTGGGCCCAAGG - Exonic
1149656177 17:58310655-58310677 GTGAGGGAGCTGCGGGGCCAGGG + Exonic
1152004878 17:77674154-77674176 GTGAAGGGCCCCCGGGACCCAGG + Intergenic
1152238535 17:79150475-79150497 GTGATGGGCAGGCGGGACCAGGG - Intronic
1152408186 17:80109132-80109154 GTGGAGGGCCCGGTGGGCCTGGG + Intergenic
1152645203 17:81465533-81465555 CTGAAGCTCCCGTGGGGCCAGGG - Exonic
1155218380 18:23662778-23662800 GTGAAGGGCCGGGGAGGACAAGG - Exonic
1157623715 18:49031341-49031363 GTGAAGGACCCTGGAGGCCAGGG + Intergenic
1160887167 19:1355294-1355316 GTGAGGGGCCCACGGCGCCAGGG - Intronic
1161238830 19:3210759-3210781 GTGCAGGGCCTGGTGGGCCACGG + Intergenic
1161280178 19:3441667-3441689 GGGAAGGGCCAGAGGGGCCGGGG + Intronic
1161301595 19:3545364-3545386 GTGCAGGGCCTGGTGGGCCATGG - Intronic
1161554042 19:4930516-4930538 GTGACGGGGATGCGGGGCCAGGG - Intronic
1161620101 19:5293161-5293183 GTGGAGGCCTCGCGGGGCCTGGG - Intronic
1163432669 19:17277573-17277595 GTGAAGGCCCAGCAGGGCCTGGG - Intronic
1163660145 19:18572021-18572043 GGGCAGGGCTCGCGAGGCCACGG + Intronic
1164705142 19:30314179-30314201 GTGAAGGGCCTGGGGGCCCCGGG + Intronic
1165446008 19:35857018-35857040 GTGAAGGGGGCTCCGGGCCAGGG + Exonic
1166762441 19:45233460-45233482 GTGAAGGGTCAGTGGGGCTATGG + Intronic
1166785538 19:45364605-45364627 GTGACGGGCCAGTGTGGCCAGGG - Intronic
1167399481 19:49255452-49255474 GAGAGGGGCCAGCAGGGCCAAGG - Intergenic
927673822 2:25090235-25090257 GGGAGGGGCCCGGGGGGCCTGGG - Intronic
930719766 2:54627794-54627816 GGTGAGGGCCAGCGGGGCCAGGG - Intronic
932709123 2:74048897-74048919 GTGTAGGGCCCAGGGAGCCAAGG + Intronic
934527708 2:95061931-95061953 GTGGAGGCCCCACGGAGCCAAGG - Intergenic
937337782 2:121072407-121072429 GGGAAGGGGACGTGGGGCCAAGG - Intergenic
938595692 2:132785105-132785127 GAGAGGGGCCCACAGGGCCAAGG - Exonic
942292492 2:174486733-174486755 GACAACGGGCCGCGGGGCCAGGG + Intronic
946032527 2:216716479-216716501 GTGAGGGGCCTCCTGGGCCAGGG + Intergenic
946241250 2:218357349-218357371 GGGAAGGCCCCCCGGGGACATGG + Intronic
948117626 2:235505351-235505373 AGGAAGGACACGCGGGGCCATGG + Intronic
948746223 2:240095900-240095922 GCGCAGGGCCCGCGGGTGCAGGG + Intergenic
949036543 2:241818209-241818231 AGGAAGGGCCCGTGGGGACAGGG - Intergenic
1168794815 20:604483-604505 GTGTAGGGACCGGGGGACCATGG - Exonic
1169112881 20:3044784-3044806 GTGAAGGGACCACTGGGCCGTGG - Exonic
1172485307 20:35294324-35294346 GTGAAGGGCCTGGGGGAGCATGG + Intergenic
1175777268 20:61661176-61661198 GGGAAGGGCCAGAAGGGCCATGG + Intronic
1175931404 20:62495580-62495602 GTGAGGGCCCCTCGAGGCCAGGG - Intergenic
1176305848 21:5122760-5122782 GTGGAGGGCACGCGGGGCAGGGG + Intronic
1177715984 21:24840377-24840399 GTGCAGGGCCCGCTGAGCCTGGG + Intergenic
1178414444 21:32392774-32392796 CTGAAGGACCCGCAGGGCCCCGG - Exonic
1179851209 21:44139271-44139293 GTGGAGGGCACGCGGGGCAGGGG - Intronic
1179893672 21:44350198-44350220 TGGATGGCCCCGCGGGGCCAGGG + Intronic
1179949752 21:44703060-44703082 GAGAAGGGCAGGGGGGGCCAGGG - Intronic
1179998521 21:44984881-44984903 GTGGAGGGGCCGTGGGGCAAAGG - Intergenic
1180102135 21:45593304-45593326 GTGATGGGACCGTGGGGCGACGG - Intergenic
1181167115 22:20989720-20989742 GTGAGGGGCACGGGGAGCCAGGG + Intronic
1183536120 22:38402400-38402422 GTTCAGGGGCCCCGGGGCCAGGG - Intergenic
1184091408 22:42294871-42294893 GTGGAGGGCCCTGGGGGACAGGG + Intronic
1184550752 22:45203087-45203109 ATGAAGGGCCCCCAGGGCAAGGG - Exonic
1184583296 22:45431106-45431128 GTGGAGGGACCGCGGGGCTGTGG + Intronic
1184690006 22:46113239-46113261 GAGAAGGCACCGTGGGGCCAGGG + Intronic
1184890433 22:47375775-47375797 CTGAAGTGCCCGAGGGGCCGGGG + Intergenic
1185350459 22:50333928-50333950 GGGAAGGGCCCCCTGGCCCATGG - Intergenic
1185398323 22:50603727-50603749 GTGGTGGGCCCGCGGGGCGCGGG + Intronic
954145487 3:48632329-48632351 GTTCAAGGCCTGCGGGGCCAGGG + Exonic
954426090 3:50443832-50443854 GTGAAGGGCTCTGGGAGCCAGGG + Intronic
959704295 3:109325406-109325428 GTGAAGAGCCACAGGGGCCAGGG - Intergenic
960689785 3:120333733-120333755 GTGAAGAGCCTGAAGGGCCAGGG - Intronic
961081794 3:124033821-124033843 GGGCAGGGCGCGGGGGGCCAGGG + Intergenic
962881264 3:139578946-139578968 CTGCAGGGCCAGCCGGGCCATGG + Exonic
963028451 3:140942379-140942401 GTTTTGGGCCCGCGGGGCCGGGG + Intronic
963038541 3:141052014-141052036 GTGAGGGGCGCGCGGGGGCCGGG + Intronic
967924154 3:194633289-194633311 GAGAAGGGCACGCGGGGCGGCGG - Exonic
968693653 4:2009465-2009487 GTGCTGGGCCCGCGGGGGCGGGG - Exonic
968944213 4:3655071-3655093 GTGATGGGCACCCAGGGCCAGGG + Intergenic
968975695 4:3821072-3821094 CTGAAGGGCCGGCAGGGACAGGG + Intergenic
972456839 4:39263450-39263472 TTGAAGGGGCAGAGGGGCCAGGG - Intronic
985894259 5:2739599-2739621 GTTCAGGGCCCCCGGGACCAGGG - Intergenic
997297474 5:132777085-132777107 GTGAGGGCCCCGCTGGGCCACGG - Intronic
997402242 5:133612120-133612142 GGGAAGGGACCGCTGGGCCAGGG - Intronic
997508447 5:134436810-134436832 GTGAAAGGCCGGCGGGGCTGGGG - Intergenic
998368307 5:141645050-141645072 GGGGAGGGCCCTCGTGGCCAGGG + Exonic
999788349 5:154912864-154912886 GTGAAGGACCCACAGGGACAAGG + Intronic
1002180133 5:177426988-177427010 GCGCAGGGCCCGCGGGCCTAGGG - Intronic
1004199611 6:13535653-13535675 GTGCAGGGGCGGCGGGGGCAGGG - Intergenic
1004241281 6:13924831-13924853 GGGAAGGGCCGGGGGGGCCCCGG + Intronic
1005944331 6:30584557-30584579 GTGAATGGCCCACCTGGCCAGGG - Exonic
1015149330 6:130020198-130020220 GAGGACGGCCCGCGGGGCCCAGG - Intronic
1015195837 6:130523996-130524018 GTGAGGGCCCTGCCGGGCCATGG + Intergenic
1017738202 6:157381897-157381919 GTGTAGGGGCCGCGGCGCCGCGG + Exonic
1018625363 6:165772504-165772526 GTCCAGGGCCCGCGTTGCCATGG + Intronic
1019663909 7:2241944-2241966 GGGCAGGGCCGGCGGGGCCGTGG - Intronic
1020032189 7:4940850-4940872 GTGAACGGCCCCCTGGGCCTGGG + Intronic
1022501280 7:30883681-30883703 GTGAAGGGCCTGCCGGGGCAAGG - Intronic
1024058549 7:45681950-45681972 GTGAAGGTCCCAAGGGGCCATGG - Intronic
1028773592 7:94655750-94655772 GGGAGGGGCCCGCGGGGGCGCGG + Intronic
1035264968 7:157685384-157685406 CTGAGGGGGCGGCGGGGCCACGG + Intronic
1039265099 8:35815708-35815730 GTGAAGTTCCGGCGGGGGCAGGG + Intergenic
1049253343 8:141601036-141601058 GTGCAGGGGTCTCGGGGCCAGGG - Intergenic
1049253354 8:141601066-141601088 GTGCAGGGGTCTCGGGGCCAGGG - Intergenic
1049594813 8:143478355-143478377 GGGAAGGGCCCGTGGGGCAGAGG + Intronic
1049716413 8:144095133-144095155 GTGTTGGGCCCGCGGGGCGCGGG + Exonic
1049767952 8:144363773-144363795 GTGAAGGGCCAGCCAGGCCGTGG + Intergenic
1049802314 8:144523568-144523590 GTGAAGGGCCTGCCGCCCCAAGG - Exonic
1053129228 9:35605678-35605700 GGGAGGGGCCCCCGGGGCCGGGG + Exonic
1055090926 9:72364613-72364635 GTGAAGGGACCGGGGCGCCGCGG - Intronic
1060658289 9:125387883-125387905 GTGAAGGCCCAGAGGGGACACGG + Intergenic
1062013745 9:134280862-134280884 GGGAAGGGCCCGGGGGGCTTCGG + Intergenic
1062427033 9:136510843-136510865 GGGAAGGGCCTGGAGGGCCAGGG - Intronic
1062504478 9:136866077-136866099 GGGAAGGGCAGGCGGGGCCTGGG - Intronic
1189383582 X:40518944-40518966 GTGAAGGGTCCTCGCTGCCATGG - Intergenic
1195756527 X:108204376-108204398 GTGGAGGTCCTGCTGGGCCAGGG + Exonic