ID: 1113909278

View in Genome Browser
Species Human (GRCh38)
Location 13:113834520-113834542
Sequence TGAAGGGCCCGCGGGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 208}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909268_1113909278 -9 Left 1113909268 13:113834506-113834528 CCCCGGAACCACCGTGAAGGGCC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909262_1113909278 6 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909264_1113909278 2 Left 1113909264 13:113834495-113834517 CCGGCGAGGGCCCCCGGAACCAC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909267_1113909278 -8 Left 1113909267 13:113834505-113834527 CCCCCGGAACCACCGTGAAGGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909257_1113909278 15 Left 1113909257 13:113834482-113834504 CCGAAAGCCCCCACCGGCGAGGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909259_1113909278 8 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909269_1113909278 -10 Left 1113909269 13:113834507-113834529 CCCGGAACCACCGTGAAGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909261_1113909278 7 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909263_1113909278 5 Left 1113909263 13:113834492-113834514 CCACCGGCGAGGGCCCCCGGAAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208
1113909255_1113909278 16 Left 1113909255 13:113834481-113834503 CCCGAAAGCCCCCACCGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909278 Original CRISPR TGAAGGGCCCGCGGGGCCAG GGG Intronic
900001658 1:17916-17938 TGCAGGGCCCGCTCGTCCAGGGG + Intergenic
900021379 1:188440-188462 TGCAGGGCCCGCTCGTCCAGGGG + Intergenic
900104176 1:975313-975335 TGAGGGGCCCGAGGTGGCAGAGG - Exonic
900653243 1:3741694-3741716 TGACAGGCCCGCGGGGTCTGCGG + Intergenic
900688806 1:3966892-3966914 GGCAGGGCCCACGGGGCAAGGGG - Intergenic
901034781 1:6329882-6329904 TGATGGGCCCGAGGGGCCCCAGG - Intronic
902549260 1:17209589-17209611 CGGAGGGCCTGGGGGGCCAGAGG - Intronic
903347118 1:22693832-22693854 TGAAGGGCCCGCATAGCCGGTGG + Intergenic
904774626 1:32899200-32899222 TGAGGGGCTGGCAGGGCCAGGGG - Intronic
905169105 1:36099180-36099202 TGAGGGGCCCGGGAGGCCAGGGG + Exonic
905308263 1:37033566-37033588 CGAAGGGCCCGCGGGGAGTGAGG + Intronic
905617200 1:39409215-39409237 CGGCGGGGCCGCGGGGCCAGCGG + Intronic
906240233 1:44238298-44238320 TGAGGCAGCCGCGGGGCCAGGGG + Intronic
906377039 1:45304108-45304130 TGGAGGGCGCGCGGGGCCGCGGG - Intronic
914196016 1:145448491-145448513 TGAGGGGCCCGGGAGGGCAGAGG + Intergenic
914428393 1:147599598-147599620 TGAGGGGCCGGCGGGGCGGGAGG - Intronic
915143221 1:153779482-153779504 TGAGGGGCCGGCGGGGGAAGTGG - Intronic
919939323 1:202275639-202275661 TCAAGGGCCCAGGGGGCAAGGGG - Intronic
922729550 1:227942558-227942580 GGAGGGGCCCTGGGGGCCAGGGG - Intronic
1072591397 10:96831990-96832012 CGAAGGCGGCGCGGGGCCAGCGG + Intergenic
1074814496 10:117134293-117134315 TGCAGCGCCCGCTGGGCCCGGGG + Exonic
1075424169 10:122328542-122328564 AGAAGGGACCACAGGGCCAGTGG + Intronic
1076664325 10:132077407-132077429 TGAAGGGCACACTGGGCCACAGG + Intergenic
1077136217 11:1000478-1000500 TGGGGGGCCCGCGGGGGCAGGGG - Exonic
1077282857 11:1753424-1753446 GGGAGGGGCCGCTGGGCCAGGGG + Exonic
1077486759 11:2842272-2842294 TGAAGGGCTCTGGGGGACAGGGG + Intronic
1078042942 11:7884838-7884860 TGAAGAGCCCACCGGGACAGGGG + Intergenic
1083260427 11:61519522-61519544 TCAAGGGCCAGAGGGGACAGGGG + Intronic
1083294349 11:61707150-61707172 TGAAGTGCCACTGGGGCCAGAGG + Intronic
1084074437 11:66762211-66762233 TGCAGGGCCCGCGAGGCCGCAGG + Intronic
1085397150 11:76212277-76212299 TGAAGTGGCCGGGGGGCCTGGGG - Intergenic
1089200900 11:116724187-116724209 TGAAGTGCCTGCGGGGCGGGTGG - Intergenic
1090408616 11:126492501-126492523 TGTAGGGGCCGAGGGGCTAGGGG + Intronic
1090698996 11:129278683-129278705 CGTGGGCCCCGCGGGGCCAGAGG - Intronic
1091374744 12:18038-18060 TGCAGGGCCCGCTCGTCCAGGGG + Intergenic
1091695873 12:2627742-2627764 TGAAGGGCCCTTGGAGACAGGGG - Intronic
1092615634 12:10213251-10213273 GGAAGGGCCCGCGGGGGCGGGGG + Intronic
1095461188 12:42446078-42446100 TGCAGGGGCTGCGGGGCCTGCGG - Exonic
1097699107 12:62802100-62802122 TGACGGGCACGCGGGGTCCGGGG - Exonic
1100330105 12:93573402-93573424 TGCTGGGCCTGCGGGGCCCGCGG - Intronic
1100871882 12:98918176-98918198 TGAAGGGCCTGAGGGGCCATGGG - Intronic
1103909935 12:124346583-124346605 TTGAGCGGCCGCGGGGCCAGGGG + Exonic
1104894148 12:132153651-132153673 TGAGGAGCCCGCTGGGGCAGAGG - Intergenic
1104941355 12:132397082-132397104 TGAAAGGCCAGGGGGGCCAGGGG - Intergenic
1105071292 12:133235750-133235772 TGAGGGACGCGCGGGGGCAGGGG - Exonic
1105871156 13:24507068-24507090 TCCGGGGCCGGCGGGGCCAGCGG + Intronic
1108478398 13:50843316-50843338 TGCAGGGCCCGCGGTCCCGGGGG + Exonic
1110524042 13:76515077-76515099 TGCAGGGCTGGCCGGGCCAGTGG + Intergenic
1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG + Intronic
1119379788 14:74221219-74221241 TGAAAGGGCCGGGTGGCCAGAGG + Intergenic
1119616411 14:76101824-76101846 GGAAGGGCCTGCAGGGCAAGAGG - Intergenic
1119666802 14:76490847-76490869 TCAAGAGCCCCCGGGGTCAGGGG - Intronic
1119808671 14:77498893-77498915 TGAGGGGCGCGCGGGGCACGGGG + Intergenic
1121697703 14:95927222-95927244 TGCAGGGGCCACGGGGGCAGTGG - Intergenic
1121818025 14:96943267-96943289 TCAAGGGCACGGGGGGCCTGTGG + Intergenic
1122183509 14:99972018-99972040 GGACGGGCGCGCCGGGCCAGGGG - Intronic
1123060515 14:105592247-105592269 TGAAGGGGCCTTGGGGCCACAGG + Intergenic
1128211967 15:65909282-65909304 GCCAGGGCCAGCGGGGCCAGGGG + Intronic
1129661493 15:77555401-77555423 TGAAGGCCCAGCTGGGGCAGGGG - Intergenic
1130002580 15:80059965-80059987 TGGTGGGCCCGCGGGGGCCGCGG + Intronic
1131510113 15:93045044-93045066 AGGAGGGGCCGGGGGGCCAGGGG + Exonic
1132090834 15:98946823-98946845 GGAAGGGCACGTGGGGCAAGAGG + Intronic
1132451851 15:101973024-101973046 TGCAGGGCCCGCTCGTCCAGGGG - Intergenic
1132455042 16:17605-17627 TGCAGGGCCCGCTCGTCCAGGGG + Exonic
1132577534 16:670910-670932 TCCAGGGCCTGCGGGGCCAGGGG - Exonic
1132698050 16:1210647-1210669 TGAAGGTACCGCGGGGCCCGGGG + Exonic
1132764378 16:1526845-1526867 AGAAGGGGCCGTAGGGCCAGGGG - Intronic
1137306709 16:47207718-47207740 TGCAGGGCCCTGGGGGCCACAGG + Intronic
1139924021 16:70475811-70475833 CCAAGGGCCCGCGGGGGGAGTGG + Intronic
1141464168 16:84195701-84195723 TGCAGGGCCCCCGGGGCAGGCGG + Intronic
1141585028 16:85027998-85028020 GGAGGGGTCCGCGGGGCGAGCGG + Intronic
1141763658 16:86044998-86045020 AGAAGGCCCTGCGGGGACAGAGG + Intergenic
1142193049 16:88726653-88726675 AGCAGGGTCAGCGGGGCCAGCGG + Intronic
1142260262 16:89039535-89039557 TCAGGGGCCCGTGGGGCCATGGG + Intergenic
1142265704 16:89063148-89063170 TGAAGTGCCGGCGGGGACGGGGG - Intergenic
1142429760 16:90019600-90019622 GGAGGGGTCCGCTGGGCCAGGGG - Intronic
1142638268 17:1270935-1270957 CGCAGGGCCCGCGGGGCGCGGGG - Exonic
1142709617 17:1716005-1716027 AGAAGGGGCGGCGGGGGCAGGGG - Intergenic
1147214708 17:38892468-38892490 GGAAGGGCCATGGGGGCCAGAGG + Intronic
1147672494 17:42184605-42184627 TGGAGGGGGCGCGGAGCCAGAGG - Intronic
1148793990 17:50188557-50188579 AGCAGGGCCAACGGGGCCAGGGG + Exonic
1151156126 17:72123905-72123927 TGCGGGGCCGGCGGGGCCTGTGG - Exonic
1151632283 17:75319048-75319070 TGATGGGCCACCGGGGCAAGAGG - Exonic
1151854364 17:76710703-76710725 TGGAGAGCCCGCGGGGCTGGGGG - Exonic
1152120070 17:78413079-78413101 TGAACGGCCTGCACGGCCAGTGG + Intronic
1152468519 17:80478260-80478282 TGGTGGGCAAGCGGGGCCAGCGG - Intergenic
1152645202 17:81465532-81465554 TGAAGCTCCCGTGGGGCCAGGGG - Exonic
1152739494 17:82012730-82012752 AGCAGGGACCGGGGGGCCAGCGG - Intronic
1152862221 17:82703086-82703108 GGGAGGGCCAGCGGGGGCAGAGG + Intergenic
1153265173 18:3262375-3262397 AGAAGGGGGCGCGGGGCCGGAGG + Intronic
1154307573 18:13241731-13241753 GGAGGGGACCGCGGGGACAGAGG - Intronic
1159954524 18:74510019-74510041 TGAGGGCTCCACGGGGCCAGAGG - Intronic
1160528317 18:79549795-79549817 TGAAGGGCCCCCGGGGGATGAGG - Intergenic
1160887166 19:1355293-1355315 TGAGGGGCCCACGGCGCCAGGGG - Intronic
1161280179 19:3441668-3441690 GGAAGGGCCAGAGGGGCCGGGGG + Intronic
1161329938 19:3681893-3681915 TGGTGGGCCTGAGGGGCCAGAGG - Intronic
1161554041 19:4930515-4930537 TGACGGGGATGCGGGGCCAGGGG - Intronic
1162346338 19:10120040-10120062 AGTAGGGCCAGCGGGGGCAGAGG + Intergenic
1162544699 19:11321700-11321722 TGCAGGGCCCCGGGGGCCACAGG + Intronic
1163432668 19:17277572-17277594 TGAAGGCCCAGCAGGGCCTGGGG - Intronic
1164191912 19:22925519-22925541 GGACGGGCCCACGGGGCCCGAGG + Intergenic
1164484644 19:28644394-28644416 TGAAGGGTCGGCGAGGGCAGGGG + Intergenic
1164634755 19:29784343-29784365 TGAGGGTCCCGTGTGGCCAGTGG - Intergenic
1164705143 19:30314180-30314202 TGAAGGGCCTGGGGGCCCCGGGG + Intronic
1165071951 19:33260934-33260956 GGAAGAGCCCGGGGGGGCAGCGG + Intergenic
1166785537 19:45364604-45364626 TGACGGGCCAGTGTGGCCAGGGG - Intronic
1167258067 19:48442897-48442919 TGAGCGGCCGGCGGGGACAGCGG - Exonic
1168325370 19:55536252-55536274 GGAAGGGCCGGCGGAGGCAGGGG - Exonic
925571688 2:5319042-5319064 TCAAGGGCCCGAGGCACCAGAGG + Intergenic
926166996 2:10527359-10527381 AGCAAGGCCCACGGGGCCAGCGG + Intergenic
926350308 2:11987948-11987970 TGCAGGGGCCAGGGGGCCAGAGG - Intergenic
931110632 2:59106945-59106967 TGAAGGGCTCGCTGGACCAGTGG + Intergenic
932722405 2:74147752-74147774 CGGAGGGACCGCGGGGCCGGCGG - Intronic
932771238 2:74502010-74502032 CGTTGGCCCCGCGGGGCCAGCGG - Intronic
934660874 2:96143066-96143088 TGAATGGGCAGAGGGGCCAGCGG - Intergenic
934966833 2:98731024-98731046 TGAGGGGCTCGCGGCGGCAGCGG - Intronic
936568065 2:113595492-113595514 TGCAGGGCCCGCTCGTCCAGGGG - Intergenic
936962325 2:118088687-118088709 TGATGGGCCTGCAGGGCAAGGGG + Intronic
940517978 2:154705000-154705022 AAAAGGGCCCACAGGGCCAGTGG - Intronic
940615793 2:156047565-156047587 TGAAAGCCACGCGGGGGCAGGGG + Intergenic
941104872 2:161341083-161341105 TGGAGAGCCCGCGGGGCTGGGGG - Intronic
942449480 2:176100110-176100132 CGAAGCGGCCGCTGGGCCAGAGG + Exonic
946308820 2:218871644-218871666 CGGGGAGCCCGCGGGGCCAGGGG - Exonic
946402433 2:219475689-219475711 TGCAGGGCTCTCAGGGCCAGGGG - Intronic
947142254 2:227030489-227030511 TGGAGGGCCTGGTGGGCCAGGGG + Exonic
948168004 2:235878037-235878059 AGAAGGGCCCACGGTGCCCGTGG + Intronic
948492166 2:238320625-238320647 TGAGGGGCGCGGGCGGCCAGCGG + Exonic
948746224 2:240095901-240095923 CGCAGGGCCCGCGGGTGCAGGGG + Intergenic
949036542 2:241818208-241818230 GGAAGGGCCCGTGGGGACAGGGG - Intergenic
949057463 2:241936443-241936465 GGAAGGGGCCGCAGGGCCGGTGG + Intergenic
1172235445 20:33369845-33369867 TGAAGGCCCCCTGTGGCCAGGGG - Intronic
1172624947 20:36341608-36341630 TGAAGGGCACGCGGCTCCCGCGG + Intronic
1172840685 20:37901470-37901492 TGAAGGGAGCGCGGGGGCTGTGG + Intergenic
1173143656 20:40506541-40506563 TGAAGGGCCCCAGGGGCCTTTGG - Intergenic
1173894660 20:46541749-46541771 TGCAGGGCCCCCGCGGCCAGCGG + Exonic
1175336026 20:58197010-58197032 GGATGGGCCAGCGGGGCTAGAGG - Intergenic
1175892817 20:62322929-62322951 TGCAGGTCCCTCGGGCCCAGGGG - Intronic
1175990338 20:62785457-62785479 TGAAGGGCGGGGTGGGCCAGGGG + Intergenic
1176108232 20:63399429-63399451 TGAAGGGGACACGGGGACAGAGG - Intergenic
1176119984 20:63450057-63450079 TGAGGGGCCTGCAGGGGCAGAGG - Intronic
1176140365 20:63542257-63542279 TGAAGGGCCTGCGGCACGAGCGG - Exonic
1176221289 20:63970292-63970314 TGCACGGCCCCCAGGGCCAGAGG - Intronic
1176246174 20:64098212-64098234 TGGAGGGCACGTGGGCCCAGAGG - Intronic
1176548777 21:8212875-8212897 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1176556672 21:8257084-8257106 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1176567708 21:8395910-8395932 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1176575611 21:8440126-8440148 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1178414443 21:32392773-32392795 TGAAGGACCCGCAGGGCCCCGGG - Exonic
1181283548 22:21736231-21736253 TGCAGGGCCCGCAGCTCCAGAGG + Intergenic
1183536119 22:38402399-38402421 TTCAGGGGCCCCGGGGCCAGGGG - Intergenic
1184690007 22:46113240-46113262 AGAAGGCACCGTGGGGCCAGGGG + Intronic
1184865421 22:47199427-47199449 AGGAGGGCCGGCGTGGCCAGAGG - Intergenic
1184890434 22:47375776-47375798 TGAAGTGCCCGAGGGGCCGGGGG + Intergenic
1185398324 22:50603728-50603750 TGGTGGGCCCGCGGGGCGCGGGG + Intronic
1203253662 22_KI270733v1_random:129180-129202 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1203261718 22_KI270733v1_random:174259-174281 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
954292378 3:49656425-49656447 TGAAGGGCCCCCAGCCCCAGGGG - Exonic
955502845 3:59602128-59602150 GGAAGGGCCACCGGGGCAAGTGG + Intergenic
959704294 3:109325405-109325427 TGAAGAGCCACAGGGGCCAGGGG - Intergenic
962060688 3:131923917-131923939 TAAAGGGACCAAGGGGCCAGTGG + Intronic
962251891 3:133840717-133840739 TCAAGGGCGCACAGGGCCAGAGG - Intronic
967858538 3:194135191-194135213 TAAAGGGCCCGCGGGCGCCGGGG + Intergenic
968534083 4:1112975-1112997 TGAGGGGCCCGTGGGGAGAGGGG - Intronic
968697591 4:2040713-2040735 TGAAACGCACGCGGGGCCCGAGG - Intronic
970597639 4:17614703-17614725 GGAAGGCCCGGCGGGGCCTGAGG - Exonic
974298015 4:60029196-60029218 TCAAGGGCCTGAGGGGTCAGGGG - Intergenic
975166812 4:71186997-71187019 TGAACGGCCCGCGAGGAAAGGGG - Intergenic
977487374 4:97665809-97665831 TGAAGGGGCTGAGGTGCCAGGGG + Intronic
982616102 4:157637757-157637779 GGACGGCCCCGCGGGGCCCGAGG - Intergenic
985026209 4:185741884-185741906 TGAAGGACCCGTGGGGCGGGAGG - Intronic
985894258 5:2739598-2739620 TTCAGGGCCCCCGGGACCAGGGG - Intergenic
986270726 5:6228426-6228448 GGGAGGGACCGCGGTGCCAGAGG - Intergenic
989097532 5:37795094-37795116 TGAAGGGCCCTGTAGGCCAGAGG + Intergenic
990381044 5:55222285-55222307 TGCAGGGCCCGTGGGTCCAGTGG + Exonic
997294271 5:132760101-132760123 TGAAGGGCCCGCAGGGCTTAAGG - Intronic
997585439 5:135040504-135040526 GGAACGGCCTGCGGGGCCACAGG - Intronic
997625807 5:135329871-135329893 TGATGGCCCTGCTGGGCCAGAGG - Intronic
998148954 5:139746391-139746413 TGCAGGGCGCGCGAGGCCAGAGG - Intergenic
1002180132 5:177426987-177427009 CGCAGGGCCCGCGGGCCTAGGGG - Intronic
1002299163 5:178247784-178247806 TGGGGGGCCAGGGGGGCCAGGGG + Exonic
1002785044 6:393608-393630 TGAAGGCCCGGCCGGGCCCGGGG + Intronic
1003181932 6:3799580-3799602 TGCAGGGCCAGGGAGGCCAGAGG - Intergenic
1004199610 6:13535652-13535674 TGCAGGGGCGGCGGGGGCAGGGG - Intergenic
1004424425 6:15497761-15497783 AGCAGGGGCCGGGGGGCCAGTGG + Intronic
1005005248 6:21281526-21281548 GGAAGGGCCAGAGGGGCCAGAGG - Intergenic
1006296931 6:33173909-33173931 TGTAGGGTCCACGGGGTCAGCGG - Exonic
1008036307 6:46749112-46749134 TGAGGGGCCAGCAGGGGCAGAGG - Intronic
1018474818 6:164130056-164130078 TGGAGGGCCAGAGGGGCCAGAGG + Intergenic
1018681595 6:166270111-166270133 GGAAGGGCCCTCGAGGGCAGAGG + Intergenic
1019190511 6:170248134-170248156 TGTGCGGCCCGCGGGGCCAGAGG + Intergenic
1019217875 6:170455177-170455199 TGCAGGCCCCGCGGGCCCTGGGG + Intergenic
1020032190 7:4940851-4940873 TGAACGGCCCCCTGGGCCTGGGG + Intronic
1020552281 7:9621697-9621719 TGCCGGGCCGGCGGGGCCGGCGG + Intergenic
1021202342 7:17741147-17741169 TGGAGGACCAGAGGGGCCAGGGG - Intergenic
1022501279 7:30883680-30883702 TGAAGGGCCTGCCGGGGCAAGGG - Intronic
1028160093 7:87475661-87475683 TGCAGCGCCCGCGCGTCCAGAGG - Exonic
1034197894 7:149262170-149262192 TAAAGGGCCAGCGGGGCACGTGG + Exonic
1034449976 7:151132099-151132121 CAGAGGGCCGGCGGGGCCAGTGG + Intronic
1038434174 8:27523053-27523075 TTCAGGGCCCGAGTGGCCAGTGG + Intronic
1038450012 8:27633872-27633894 GGAAGGGTGCGCGGGGCGAGGGG + Intronic
1038495521 8:27999420-27999442 TGAAGGGCAGGCAGTGCCAGAGG - Intergenic
1039265100 8:35815709-35815731 TGAAGTTCCGGCGGGGGCAGGGG + Intergenic
1040474552 8:47764702-47764724 AGAGGGGCCCCCGGGGGCAGGGG - Intergenic
1040559924 8:48514826-48514848 TGGCTGGCCCGCGGGTCCAGGGG - Intergenic
1049253342 8:141601035-141601057 TGCAGGGGTCTCGGGGCCAGGGG - Intergenic
1049253353 8:141601065-141601087 TGCAGGGGTCTCGGGGCCAGGGG - Intergenic
1049330168 8:142046202-142046224 TAAATTGCCTGCGGGGCCAGGGG + Intergenic
1049716414 8:144095134-144095156 TGTTGGGCCCGCGGGGCGCGGGG + Exonic
1049721184 8:144116213-144116235 TGCAGGAGCCGCGGGGGCAGCGG - Exonic
1049761435 8:144333682-144333704 CGAGGCGCGCGCGGGGCCAGGGG - Exonic
1049814435 8:144591576-144591598 TGAAGGCTCCGGGAGGCCAGTGG + Intronic
1049884466 9:18029-18051 TGCAGGGCCCGCTCGTCCAGGGG + Intergenic
1053129229 9:35605679-35605701 GGAGGGGCCCCCGGGGCCGGGGG + Exonic
1056852150 9:90093789-90093811 TGAAGGGCCGGTGGGACCACAGG - Intergenic
1059395215 9:114030007-114030029 TGAAGGGCCCGCGGTCCCAGAGG - Intronic
1059456698 9:114404206-114404228 TGAAGAGATCGTGGGGCCAGAGG + Intronic
1060215508 9:121736316-121736338 TGAGGGGCTGGCGGGGCCGGTGG + Intronic
1060821072 9:126661849-126661871 TGCAGGGGCCACTGGGCCAGGGG - Intronic
1060840343 9:126788566-126788588 TGAAAGGTCCTCGGGGTCAGTGG - Intergenic
1060849358 9:126861157-126861179 TGGAGAGCCGGCCGGGCCAGGGG + Intronic
1061847304 9:133394933-133394955 TGGAGTGCTCGCGGGGCCAGTGG - Intronic
1062427032 9:136510842-136510864 GGAAGGGCCTGGAGGGCCAGGGG - Intronic
1062620400 9:137417896-137417918 TGAGGGGCTGGCGGGGCCGGAGG + Intronic
1062698718 9:137888344-137888366 TGAGGGGCCCGGGAGGGCAGAGG - Intronic
1203470062 Un_GL000220v1:112328-112350 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1203477883 Un_GL000220v1:156300-156322 CGCAGGGCCCGCGGGGGGAGGGG - Intergenic
1190832055 X:54067618-54067640 TGAAGGGACCGTGGAGTCAGGGG + Intergenic
1200401340 X:156022122-156022144 TGCAGGGCCCGCTCGTCCAGGGG - Intergenic
1200787644 Y:7274061-7274083 TGCACGCCCCGCGAGGCCAGCGG + Intergenic