ID: 1113909282

View in Genome Browser
Species Human (GRCh38)
Location 13:113834536-113834558
Sequence CCAGGGGCCGCCTACCTCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113909275_1113909282 -4 Left 1113909275 13:113834517-113834539 CCGTGAAGGGCCCGCGGGGCCAG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909268_1113909282 7 Left 1113909268 13:113834506-113834528 CCCCGGAACCACCGTGAAGGGCC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909274_1113909282 -1 Left 1113909274 13:113834514-113834536 CCACCGTGAAGGGCCCGCGGGGC 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909261_1113909282 23 Left 1113909261 13:113834490-113834512 CCCCACCGGCGAGGGCCCCCGGA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909262_1113909282 22 Left 1113909262 13:113834491-113834513 CCCACCGGCGAGGGCCCCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909259_1113909282 24 Left 1113909259 13:113834489-113834511 CCCCCACCGGCGAGGGCCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909267_1113909282 8 Left 1113909267 13:113834505-113834527 CCCCCGGAACCACCGTGAAGGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909270_1113909282 5 Left 1113909270 13:113834508-113834530 CCGGAACCACCGTGAAGGGCCCG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909269_1113909282 6 Left 1113909269 13:113834507-113834529 CCCGGAACCACCGTGAAGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909264_1113909282 18 Left 1113909264 13:113834495-113834517 CCGGCGAGGGCCCCCGGAACCAC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1113909263_1113909282 21 Left 1113909263 13:113834492-113834514 CCACCGGCGAGGGCCCCCGGAAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG 0: 1
1: 0
2: 0
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909282 Original CRISPR CCAGGGGCCGCCTACCTCAC AGG Exonic
900289759 1:1918934-1918956 CCAGGTGCCGCCGTCCCCACAGG - Exonic
900315479 1:2054022-2054044 CCAGGGCCCACCTGCCCCACAGG - Intronic
900371064 1:2332432-2332454 CCAGGGGTCGCCCATCCCACTGG - Intronic
900408952 1:2504274-2504296 CCAGGGGCCGCCACCCTCCCAGG - Exonic
900526489 1:3131751-3131773 CCAGGCCCCGCAAACCTCACAGG + Intronic
900682629 1:3925245-3925267 CCAGGTGCCACGTACCTCAAAGG + Intergenic
900890972 1:5449426-5449448 CCAGAGGCCGCCTGCATCCCTGG - Intergenic
901783751 1:11610993-11611015 CCAGGTGCCTCCTCCCTCCCTGG - Intergenic
902602914 1:17552145-17552167 GCAGGGACTGCCTCCCTCACTGG - Intronic
902870818 1:19312546-19312568 CCAGTGGCCCCCCACCTCAAAGG + Exonic
903043968 1:20552502-20552524 CCCCGGGCTGCCTACATCACCGG - Exonic
913610389 1:120504732-120504754 CCATGGGCCTCCTCCCACACAGG + Intergenic
913984415 1:143552103-143552125 CCATGGGCCTCCTCCCACACAGG - Intergenic
914580801 1:149017507-149017529 CCATGGGCCTCCTCCCACACAGG - Intronic
916988687 1:170218776-170218798 ACAGGTGCTGCCTGCCTCACTGG - Intergenic
920310438 1:205045068-205045090 CCAAGGTCCACCTGCCTCACAGG + Intronic
1062882290 10:988520-988542 CCCGGGGCCGCCTACCTTGGCGG - Exonic
1069865673 10:71501480-71501502 CTAGAGGCCGCCTGCCTCTCAGG + Intronic
1071089099 10:81898121-81898143 CCAGGGGCCACCCTCCTAACAGG - Intronic
1072031346 10:91525361-91525383 CCAGGAGCCTCCTACCTCTGGGG - Intergenic
1075574146 10:123566386-123566408 CCAGAGGCCACCTCCCTCAGTGG - Intergenic
1076401770 10:130189764-130189786 CCAGGGGCTGCGTACCTCCCCGG - Intergenic
1076990610 11:271435-271457 CCGGGGGCAGCCTCCCTCCCTGG - Intergenic
1077226199 11:1440075-1440097 CCAGGGGCCACCACCCTCACAGG + Intronic
1081807072 11:45896567-45896589 GCTGTGGCCGCCTCCCTCACGGG - Intronic
1084486890 11:69453427-69453449 CCCGGGGCAGCCAACCCCACTGG - Intergenic
1085519900 11:77131629-77131651 CCAGGGGCGTCCTCCCTCAGGGG + Intronic
1089146706 11:116334752-116334774 CCAGCAGCTGTCTACCTCACAGG - Intergenic
1089162256 11:116447605-116447627 CCACTGGCCCCCTTCCTCACTGG - Intergenic
1092154153 12:6271555-6271577 CCTGAGGCTGCCTACCTCAGGGG + Intergenic
1104757428 12:131277881-131277903 CCAGCTGCTGCCTCCCTCACGGG - Intergenic
1106108890 13:26760246-26760268 CCAGGGGCCGCCATCCTCGATGG + Intronic
1113909282 13:113834536-113834558 CCAGGGGCCGCCTACCTCACAGG + Exonic
1114548805 14:23521844-23521866 CCTGGCCCCGCCCACCTCACAGG - Exonic
1117007856 14:51440555-51440577 CTAAGGGTAGCCTACCTCACTGG - Intergenic
1119601386 14:75979382-75979404 CCAGGAGCTGCCCACCTCCCAGG + Intronic
1119859493 14:77925954-77925976 GGAGGGGCCCCCTACCTCAGTGG - Exonic
1122030597 14:98908762-98908784 CCAGGTGGTACCTACCTCACTGG - Intergenic
1122695475 14:103550154-103550176 CCAGGGGCTGTCTCCCTCCCTGG - Intergenic
1125524824 15:40368255-40368277 GCAGGGGGCGCCTACATCGCCGG + Exonic
1125641167 15:41231539-41231561 CCAGGACCCCCCAACCTCACAGG - Intronic
1125745320 15:41993742-41993764 ACAGGGGCCTCCTCCCTCACAGG + Intronic
1127278959 15:57472525-57472547 CCCAGGGCCTCCCACCTCACTGG - Intronic
1127922853 15:63506396-63506418 CTAGGAGAAGCCTACCTCACAGG + Intronic
1131394754 15:92077499-92077521 CCAGGGAATGCCTGCCTCACTGG - Intronic
1132975405 16:2708767-2708789 CCAGCGGCCGCCTTCCTCCCAGG - Exonic
1134865310 16:17601758-17601780 CCTGGGGCCTTCTATCTCACTGG - Intergenic
1138534457 16:57652669-57652691 CCAGGGCCTGCCTTCCTCAGTGG + Intronic
1141706358 16:85667347-85667369 CCAGGGGCTGCCATCCCCACGGG + Intronic
1143666598 17:8365714-8365736 CCTGGTGCTGCCTACCTCACAGG - Intergenic
1144698090 17:17319251-17319273 CCAGGGGCTGCCTAGCTCTAAGG - Intronic
1145041763 17:19582449-19582471 ACAGGGGCCAGCTAGCTCACTGG - Intergenic
1151322197 17:73358912-73358934 CCTAGGGCCGGCTCCCTCACTGG - Intronic
1152005884 17:77680898-77680920 GCAGGGGGAGCTTACCTCACAGG + Intergenic
1153833395 18:8943048-8943070 ACAGGGGACGCCTACGCCACAGG + Intergenic
1157725816 18:49962849-49962871 CCAGGGCCCACCCACCTCAGAGG + Intronic
1160575993 18:79854052-79854074 CCAGGGGCCGCCTGCAGAACGGG - Intergenic
1161031504 19:2059862-2059884 CCTGGGGCTGCCTACCTGCCCGG + Intergenic
1161654849 19:5507879-5507901 CCAGGGACCGCCTCTGTCACTGG - Intergenic
1163209221 19:15828484-15828506 CCAGGGGACTCCTCCCTCCCGGG + Intergenic
1163721563 19:18900366-18900388 CTGGGGGCCGCTTACCTCAGGGG + Exonic
1164571733 19:29379640-29379662 CCAGGGGCCAGCTCCCTCCCTGG - Intergenic
1164736936 19:30548563-30548585 CCAGATGCCGCCTCCCTCCCGGG + Exonic
1165353889 19:35292076-35292098 CCAGGGGCCGCCTGCCTCCAGGG - Intergenic
1165912231 19:39236655-39236677 CCCGGGGCCGCCTCCACCACTGG - Intergenic
1165921096 19:39298244-39298266 CCCGGGGCCGCCTCCACCACTGG + Exonic
1167903363 19:52638400-52638422 CCAGGCCCCGCCCACCTCGCGGG - Intronic
1167943055 19:52962922-52962944 CCAGGCCCCGCCCACCTCTCGGG - Intergenic
925408770 2:3626857-3626879 CCGGGCACCGCCTACCACACAGG - Intronic
927452971 2:23224481-23224503 CCAGGAGCCACCAACCACACGGG + Intergenic
928916597 2:36478540-36478562 CCATTGGCCGCCTCCCTCTCTGG + Intronic
931121440 2:59224823-59224845 CCAGGGGCTTCCTAACTCCCAGG + Intergenic
933864720 2:86505785-86505807 CTAGGGGCTGCCTACCCCGCTGG - Exonic
937222008 2:120347129-120347151 CCTGGGGCCGCTTCCATCACCGG + Intronic
937394921 2:121526209-121526231 CCAGGTCCCGCTTGCCTCACAGG + Intronic
941008241 2:160269627-160269649 CCAGGCACTGCCTGCCTCACAGG - Intronic
942555448 2:177168175-177168197 CCAGTGACAGCCTTCCTCACAGG + Intergenic
946333107 2:219021496-219021518 CCAGGTGGCACCTACCTCACAGG - Intronic
946420625 2:219562577-219562599 CCAGGGCCGGCATAGCTCACAGG + Exonic
949063365 2:241974315-241974337 CCAGGGGCCTCTGACCTCCCGGG - Intergenic
949079540 2:242085794-242085816 CCAGGTGCCCCCTGCCTCACAGG - Intergenic
1172995642 20:39068716-39068738 TCAGAGGCTGCCTACCACACAGG + Intergenic
1173059966 20:39651528-39651550 CCAGGGGCCCCCTACCTATGTGG - Intergenic
1173516364 20:43667653-43667675 CCAGGGGTCGCCTCCCTCGCCGG - Intronic
1175128978 20:56774993-56775015 CCAGGTCCCGCCTACAACACTGG - Intergenic
1175133838 20:56808532-56808554 CCAGGGCCAGCCTGCCTCCCGGG + Intergenic
1175172384 20:57089819-57089841 CCAAGGGCCTCCTCCCTTACAGG - Intergenic
1175931480 20:62495834-62495856 CCAGGGGCCGCCAGCTCCACGGG - Intergenic
1181005622 22:20012135-20012157 TCATGGGCCTCCTACCTCATGGG + Intronic
1182289544 22:29267411-29267433 CCAGGCCCTGCCTACCTTACTGG + Exonic
1182835022 22:33334834-33334856 CCAGGAGCCGTGTAGCTCACGGG - Intronic
1183335905 22:37245668-37245690 CCTGGGGCTTCCTCCCTCACAGG + Intergenic
1183978121 22:41524888-41524910 CCAGAGACCGACTACCTGACGGG + Exonic
1184656441 22:45944293-45944315 CCAGCAGCCGCCTAGCCCACAGG + Intronic
1185100703 22:48839447-48839469 GAAGGGGCTGCCTACCTCCCTGG + Intronic
1185324754 22:50220177-50220199 CCACTGCCCGCCTACCTCCCAGG + Intronic
950438364 3:12993784-12993806 TCAGCGGCCGCCAAGCTCACGGG - Intronic
953744664 3:45565115-45565137 CCAGAGACAGCCTTCCTCACTGG + Intronic
955508813 3:59658875-59658897 CCAGGGGCTGCCTACATGATAGG + Intergenic
959514380 3:107249082-107249104 GGAGGAGCCCCCTACCTCACAGG + Intergenic
960920406 3:122740988-122741010 CCAGAAGCCGCCTACCTCAGTGG + Exonic
965723185 3:171684433-171684455 CCAGAGGCCTCCTACTTCCCAGG + Intronic
966984337 3:185165721-185165743 GTAGGGGCCTCCTACCTCTCGGG + Intergenic
968423848 4:507714-507736 CCAGGGGCCGCATGCCACACGGG + Intronic
969227335 4:5807581-5807603 CCAGGGCCCACCTCCCTCTCTGG - Intronic
985639889 5:1058673-1058695 CCTGGGGCTGCCTCCCTCTCTGG + Intronic
989600001 5:43192246-43192268 TCAGGGGCGGCCGACCTGACCGG - Intronic
998215782 5:140237861-140237883 CCAGGGGCAGCCTCCCTCCCAGG + Intronic
998790903 5:145765533-145765555 CCAGGGGCAGCATACATCATTGG + Intronic
999180368 5:149665984-149666006 CCAGGGGCAGTCTGCCTCTCTGG + Intergenic
1001901500 5:175434397-175434419 CCAAGGGCTGCCTCACTCACTGG + Intergenic
1005829931 6:29662568-29662590 CCAGGGACCACCCACCTCACCGG + Intronic
1006836669 6:37003022-37003044 CCTGGGGGCGCCTCCCTCCCTGG - Intergenic
1007684001 6:43654139-43654161 CCATGGGCAGCCTACCTGAATGG - Intronic
1007737058 6:43988204-43988226 CCTGCGACCCCCTACCTCACAGG - Intergenic
1014644657 6:123958346-123958368 CCTGGGGCATCCTGCCTCACAGG - Intronic
1019014941 6:168873422-168873444 GCAGGGGACGCCAAGCTCACAGG - Intergenic
1019061262 6:169259842-169259864 ACTGGAGCCCCCTACCTCACAGG + Intergenic
1022137764 7:27465663-27465685 CCATGGGGGCCCTACCTCACTGG - Intergenic
1023968154 7:44974076-44974098 CCAGGGGGCTCCCACCTCAGTGG + Intronic
1024084749 7:45883916-45883938 CCAGGCGCCGGCTCCCTCCCTGG + Intergenic
1024157212 7:46638082-46638104 CCAGGGGCTGCCGAGCTCCCTGG - Intergenic
1029315481 7:99709020-99709042 CCAGGGGCCTCCTACCTTTCAGG + Exonic
1034198047 7:149262704-149262726 GCAGGGGCCGCCAGCCCCACGGG + Intronic
1035451388 7:158979347-158979369 CCAGCGGCCTCCTGCCTCCCTGG + Intergenic
1035537610 8:404314-404336 CCAGGTGCCCCCTGCCTCACAGG - Intergenic
1049347966 8:142148837-142148859 GCAGGGGCCGCTCACCTCAGGGG - Intergenic
1050191662 9:3032954-3032976 CCTGGTGCTGCCTGCCTCACTGG - Intergenic
1052827101 9:33185162-33185184 CCAGGGGCCGACTAGCTTTCCGG - Intergenic
1053372712 9:37576196-37576218 GCACCGGCCGCTTACCTCACAGG + Exonic
1054901824 9:70377291-70377313 CCAGGCCCCACCTCCCTCACTGG - Intergenic
1055620601 9:78121291-78121313 CCAGGGATGGCTTACCTCACTGG + Intergenic
1059268847 9:113060258-113060280 CCGGGGGGCGCCTTCCTCCCGGG - Intergenic
1059269983 9:113065707-113065729 CCGGGGGGCGCCTTCCTCCCGGG - Intergenic
1059271117 9:113071155-113071177 CCGGGGGGCGCCTTCCTCCCGGG - Intergenic
1059272250 9:113076601-113076623 CCGGGGGGCGCCTTCCTCCCGGG - Intergenic
1059273385 9:113082043-113082065 CCGGGGGGCGCCTTCCTCCCGGG - Intergenic
1059274521 9:113087489-113087511 CCGGGGGGCGCCTTCCTCCCGGG - Intergenic
1061412023 9:130427062-130427084 CCTGGGGCTGCCTGACTCACTGG + Intronic
1062014130 9:134282796-134282818 GCAGGGGCAACCTTCCTCACTGG - Intergenic
1185589503 X:1265095-1265117 CCAGGTCCCACCTACCACACAGG - Intergenic
1195254761 X:103080866-103080888 CCAGGGCTCTGCTACCTCACTGG + Intronic
1198721910 X:139631431-139631453 CAAGGTGCCGCCTAACTCAGGGG + Exonic