ID: 1113909876

View in Genome Browser
Species Human (GRCh38)
Location 13:113836721-113836743
Sequence GAGGGGAATGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6016
Summary {0: 1, 1: 7, 2: 105, 3: 1109, 4: 4794}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113909876 Original CRISPR GAGGGGAATGAGGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr