ID: 1113912051

View in Genome Browser
Species Human (GRCh38)
Location 13:113847033-113847055
Sequence CAGACATCCCGCTAGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113912047_1113912051 12 Left 1113912047 13:113846998-113847020 CCATGCTCTCTGGCTGGCTGAAC 0: 1
1: 0
2: 2
3: 67
4: 347
Right 1113912051 13:113847033-113847055 CAGACATCCCGCTAGGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1113912044_1113912051 17 Left 1113912044 13:113846993-113847015 CCCCTCCATGCTCTCTGGCTGGC 0: 1
1: 0
2: 2
3: 36
4: 487
Right 1113912051 13:113847033-113847055 CAGACATCCCGCTAGGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1113912046_1113912051 15 Left 1113912046 13:113846995-113847017 CCTCCATGCTCTCTGGCTGGCTG 0: 1
1: 0
2: 0
3: 43
4: 341
Right 1113912051 13:113847033-113847055 CAGACATCCCGCTAGGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 38
1113912045_1113912051 16 Left 1113912045 13:113846994-113847016 CCCTCCATGCTCTCTGGCTGGCT 0: 1
1: 0
2: 3
3: 46
4: 541
Right 1113912051 13:113847033-113847055 CAGACATCCCGCTAGGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113912051 Original CRISPR CAGACATCCCGCTAGGGCGG CGG Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
1067807373 10:49402426-49402448 CAGAAGTTCCTCTAGGGCGGTGG - Intergenic
1074382312 10:112991162-112991184 CAGAGATCTTGCTAGGGGGGTGG + Intronic
1078197641 11:9149645-9149667 CAGACATCCCGAGAGGGGTGAGG + Intronic
1091170698 11:133517530-133517552 CATACTTACCGCTAGGGCGGTGG + Intronic
1092159879 12:6310480-6310502 CAGCCCTCCCGCTCGGCCGGCGG + Intronic
1094425265 12:30310385-30310407 CAGACATTCCCCTAGGAAGGGGG + Intergenic
1113911312 13:113842721-113842743 CAGACATCCCTCCATGGTGGGGG - Intronic
1113912051 13:113847033-113847055 CAGACATCCCGCTAGGGCGGCGG + Intronic
1119309839 14:73636602-73636624 CAGACATCCGGCCAGCACGGTGG + Intergenic
1123998921 15:25738349-25738371 CAGATATCCAGCTAGGGAAGAGG + Intronic
1136479422 16:30532582-30532604 CAGACAGCCCCCCAGGGCGCCGG + Exonic
1138506135 16:57479227-57479249 CAGCCAGCCCTCTGGGGCGGGGG + Intronic
1138544448 16:57707378-57707400 CAGACATCTCCCTGGGGCTGGGG - Intronic
1161202696 19:3024839-3024861 CAGGCATCCCGCTGGGGCAGGGG - Intronic
1163608810 19:18290693-18290715 CAGACAGCCAGGGAGGGCGGCGG - Intergenic
937044039 2:118841702-118841724 CCGACAGCCCGCTTGGGCGAGGG - Intergenic
937222794 2:120351808-120351830 CAGACATCACGCAAGGCAGGAGG - Exonic
947696324 2:232193003-232193025 CAGCCATCCCACTAAGGAGGAGG - Intronic
1172619801 20:36311385-36311407 CAGACAGCTCGGTAGGGAGGAGG - Intronic
1175072698 20:56347635-56347657 CAGATATCCCGATAGGACAGTGG + Intergenic
1176023702 20:62975283-62975305 CAGACATGCACCTAGGGTGGGGG + Intergenic
1179034197 21:37745826-37745848 CACACGTCCCACTAGGGCAGCGG + Intronic
1180997642 22:19973375-19973397 CAGGGATCCCGCGAGGGCGAGGG + Intronic
1181277307 22:21695024-21695046 CAGACCTTCCGCCAGGGCGTGGG + Exonic
1181880282 22:25973781-25973803 CAGACTTCTCCCTAGGGTGGAGG + Intronic
961650402 3:128414153-128414175 TAGACATCACTCTAGGGCTGGGG - Intergenic
966931373 3:184677938-184677960 CAGAAATCCCTCCAGGGAGGAGG + Intronic
969587424 4:8102454-8102476 CAGACATCCCGTTATGGGGATGG - Intronic
975370173 4:73576688-73576710 CAGACATTCCGCTACTGCAGAGG - Exonic
992150991 5:73902957-73902979 CAACCATCCCTCTAGGGCGGGGG + Intronic
998019038 5:138754013-138754035 GAGACTTCCCGATGGGGCGGCGG + Intronic
1007111082 6:39313858-39313880 CAGTCCTCTCGCTAGGGCGAGGG + Intronic
1007610132 6:43143749-43143771 CAGGCTTCCCGCTAGGGGTGGGG - Intronic
1007764327 6:44152071-44152093 CAGCCATCGCGCTAGGGTTGAGG + Intronic
1028530901 7:91837606-91837628 CAGACAACCCTCTAGGGAGCAGG + Intronic
1029638809 7:101805093-101805115 CAGACATCTCTCTGCGGCGGTGG - Intergenic
1032066677 7:128776425-128776447 CAGACCTCCAGCCAGGGAGGTGG + Intergenic
1035337789 7:158141154-158141176 CCGAGATCCCTCTAGGGCAGAGG - Intronic
1057602034 9:96466852-96466874 CAGGCTTCCCGCTAGTGCAGAGG + Intronic
1061494297 9:130962925-130962947 CAGACAGCCCCCCGGGGCGGGGG - Intergenic
1189198334 X:39170110-39170132 CAGACATATAGCCAGGGCGGTGG - Intergenic