ID: 1113913219

View in Genome Browser
Species Human (GRCh38)
Location 13:113854528-113854550
Sequence TGCTCCCGACAGCCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113913215_1113913219 2 Left 1113913215 13:113854503-113854525 CCGTCTCTGCCCCAAACACAGAG 0: 1
1: 0
2: 7
3: 54
4: 543
Right 1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 251
1113913216_1113913219 -7 Left 1113913216 13:113854512-113854534 CCCCAAACACAGAGCATGCTCCC 0: 1
1: 0
2: 5
3: 19
4: 284
Right 1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 251
1113913218_1113913219 -9 Left 1113913218 13:113854514-113854536 CCAAACACAGAGCATGCTCCCGA 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 251
1113913214_1113913219 3 Left 1113913214 13:113854502-113854524 CCCGTCTCTGCCCCAAACACAGA 0: 1
1: 0
2: 4
3: 76
4: 1534
Right 1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 251
1113913217_1113913219 -8 Left 1113913217 13:113854513-113854535 CCCAAACACAGAGCATGCTCCCG 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG 0: 1
1: 0
2: 2
3: 24
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113913219 Original CRISPR TGCTCCCGACAGCCCCCAGC AGG Intronic
900140491 1:1137507-1137529 TGTTCCCGGAAACCCCCAGCCGG - Intergenic
900422605 1:2562088-2562110 TGCTCCCCACATCCCACAGGGGG - Intronic
900488230 1:2933570-2933592 TGCTCCCCGCAGACCCCTGCAGG + Intergenic
900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG + Intronic
900671767 1:3858789-3858811 TGTTCCCGACAACGCCGAGCTGG + Exonic
901025609 1:6277287-6277309 CTCTCCCGGCTGCCCCCAGCTGG - Intronic
901323908 1:8355918-8355940 TACCCCAGACAGCCCCCAGAGGG + Intronic
901811174 1:11767408-11767430 GGCTCCCTTCATCCCCCAGCAGG - Intronic
903312645 1:22471894-22471916 TGCTTCCCACAGCCCCTCGCCGG - Intronic
904201570 1:28823048-28823070 TCCACCCCACAGCTCCCAGCCGG - Intronic
904449116 1:30599725-30599747 TCCTCCTGACAGCCCCAGGCAGG + Intergenic
906600779 1:47127337-47127359 TGCTCCCGCCACCCCACAACAGG - Intergenic
910205214 1:84742838-84742860 TGCTCCCCACAGCCACCCTCTGG - Intergenic
910835229 1:91501448-91501470 TTCTCCCTGCAGCCCCCTGCCGG + Intronic
912447739 1:109750668-109750690 TCCTTCTGACAGCCTCCAGCCGG + Exonic
914171821 1:145232854-145232876 GGCTCCCGCCCGCTCCCAGCCGG + Intergenic
915020767 1:152776654-152776676 TGCTGCAGCCAGCCCTCAGCGGG + Exonic
917715188 1:177728186-177728208 TGCCCCCGACCCCCCCGAGCAGG - Intergenic
917914137 1:179684195-179684217 TGCTCCCCACACCCCACAACAGG + Intronic
919939516 1:202276557-202276579 TGCAGCCCCCAGCCCCCAGCAGG - Intronic
920226932 1:204446045-204446067 TGCTCGCCAGCGCCCCCAGCTGG - Exonic
920522113 1:206635541-206635563 CGCTCCCGACTGGCCCCGGCTGG - Exonic
921179407 1:212619807-212619829 TGTTCCAGATGGCCCCCAGCTGG + Exonic
922752450 1:228076927-228076949 TGCTCCGTGCAGCCCCAAGCTGG + Intergenic
922765998 1:228157078-228157100 TCCTCCCTCCAGCCCCCGGCTGG - Intronic
1067174175 10:43930839-43930861 TCCTCCACACAGCCCCAAGCAGG - Intergenic
1067238158 10:44468886-44468908 TGCTCCAGGCAGCTCCCAGATGG - Intergenic
1069861907 10:71476811-71476833 TGCTCCCTCCTGCTCCCAGCCGG + Intronic
1071903046 10:90141178-90141200 TGCTCCTCACAGCACCCACCAGG - Intergenic
1072805869 10:98423806-98423828 TTCTGACCACAGCCCCCAGCAGG - Exonic
1073320250 10:102611868-102611890 TGCCCCTGGCAGTCCCCAGCGGG + Intronic
1074571335 10:114626972-114626994 TTCTCCTGACAGCCCTCAGAAGG + Intronic
1075668761 10:124248810-124248832 TTCTCCCTGCAGCCTCCAGCGGG + Intergenic
1076121711 10:127941489-127941511 TGCTCCTGTGAGCCCACAGCGGG - Intronic
1077539360 11:3139319-3139341 TGCCCCTGGCAGACCCCAGCAGG - Intronic
1077806167 11:5593288-5593310 TGTTCCCATCAGCTCCCAGCTGG + Intronic
1078091773 11:8268530-8268552 TGCTCCCGCCGGCCCCGCGCGGG + Intronic
1079078356 11:17397241-17397263 TGCGCTTCACAGCCCCCAGCTGG + Exonic
1081732968 11:45384584-45384606 AGCTTCTTACAGCCCCCAGCTGG - Intergenic
1081813550 11:45926565-45926587 TGCCCCAGCCAGCCCCCACCTGG + Exonic
1083425341 11:62581527-62581549 GGCCCCCGACAGTCACCAGCTGG - Exonic
1083627265 11:64078105-64078127 TGCTGCCTGCAGCCCCAAGCCGG - Intronic
1083807265 11:65082172-65082194 TTCTCCCCACAGCCCCCAGAGGG + Intronic
1084756725 11:71244286-71244308 GGCTTCAGACAGCCACCAGCTGG - Intronic
1084965030 11:72739994-72740016 TGCTCCCCACAGTCCCCAAGGGG - Intronic
1085455005 11:76660672-76660694 TGCCCCTCTCAGCCCCCAGCGGG - Exonic
1090943458 11:131409322-131409344 TGCCCCTGAGAGCCCCCATCTGG + Intronic
1090973231 11:131660492-131660514 TCCTCCCGAGAGGCACCAGCCGG + Intronic
1091317735 11:134626317-134626339 TGCTTCCAAAAGCTCCCAGCTGG + Intergenic
1091363028 11:134993272-134993294 TGCTCCCCAAAGCCTCCAGAAGG + Intergenic
1091589734 12:1836114-1836136 GGCTCCCTAGAGCACCCAGCCGG + Exonic
1092745234 12:11666795-11666817 TGCAACAGAAAGCCCCCAGCAGG - Intronic
1093845385 12:23965009-23965031 AGCTCCCAGCAGCCCCCAGGGGG + Intergenic
1094498320 12:31002916-31002938 TCCTCCCCACAGCCCGCAGCTGG - Intergenic
1096182280 12:49557540-49557562 TACTGCCTGCAGCCCCCAGCTGG + Exonic
1096210767 12:49763805-49763827 TGCTCCCCACTGCCCCAAACAGG - Exonic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096750531 12:53756113-53756135 TGCTCTCCACAACCCCCAGCAGG - Intergenic
1100460622 12:94795751-94795773 TGCTGCTGGCAGCCACCAGCAGG - Intergenic
1102330025 12:112021140-112021162 TCCTCCCAACAGCCCCCATGTGG + Intronic
1103937564 12:124484630-124484652 TGCTCCAGGCAGAGCCCAGCAGG - Intronic
1104070496 12:125340928-125340950 TGCTCCCAACTGGCCCCTGCAGG - Intronic
1104501984 12:129294746-129294768 TGCTCCCATCACCCCCCTGCAGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1106568455 13:30906456-30906478 CGGTGCCTACAGCCCCCAGCCGG - Exonic
1108604284 13:52021773-52021795 GATGCCCGACAGCCCCCAGCAGG - Intronic
1108815582 13:54286782-54286804 TGTTCCCCACACCACCCAGCTGG - Intergenic
1109760866 13:66827184-66827206 TTCTCCCCATAACCCCCAGCAGG + Intronic
1111116120 13:83779897-83779919 TGCTCATGCCAGCCCCCAGAGGG - Intergenic
1112092845 13:96100528-96100550 AGCTCCTGTCAGCCACCAGCAGG - Intronic
1113319136 13:109214979-109215001 TGATCCAGTCAGCTCCCAGCAGG + Intergenic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1113946697 13:114048511-114048533 TGCTCCTGACAGCACCGAGCCGG + Intronic
1114210170 14:20607269-20607291 TACTCCCCTCAGCCCTCAGCTGG + Intronic
1115771046 14:36663896-36663918 TGCAGCCGGCAGCCCCAAGCAGG - Intronic
1120761592 14:88290314-88290336 TTCTCCCTAAAGCCCCCAGAAGG + Intronic
1120765957 14:88326606-88326628 TGCACTCGCCGGCCCCCAGCAGG + Intronic
1122275227 14:100587488-100587510 TCCTCCCGGCAGCGCCCGGCCGG + Intergenic
1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG + Intergenic
1122436666 14:101705845-101705867 TGCTCCCGGAAGCCCCTGGCGGG - Intergenic
1122637136 14:103135413-103135435 TGCTCTTAACAGCTCCCAGCGGG - Exonic
1122647059 14:103201878-103201900 CCCTCCCCACAGCCCCCAGGTGG - Intergenic
1122825952 14:104370547-104370569 TGCTCCCTCCAGGCCCCAGCTGG + Intergenic
1124212091 15:27771463-27771485 TTCTCCAGGCAGCGCCCAGCTGG + Intronic
1124626155 15:31308556-31308578 TTCTCCCCACAGCCTGCAGCTGG - Intergenic
1124706622 15:31972024-31972046 AGCTCCCCACCTCCCCCAGCAGG + Intergenic
1125300989 15:38252981-38253003 TGCTGCCGCCACCCCCCTGCGGG + Exonic
1128304314 15:66588096-66588118 TCCTCCCAAATGCCCCCAGCAGG - Intronic
1128511342 15:68315791-68315813 CACTCCCCACAGCCCCCTGCTGG + Intronic
1128726319 15:69991143-69991165 TGCGCTCGACTGGCCCCAGCTGG + Intergenic
1128795049 15:70460372-70460394 TGCTCCTGCCAGCCACCAGGGGG - Intergenic
1129870510 15:78937231-78937253 TCCACCCACCAGCCCCCAGCGGG + Intronic
1131825756 15:96321825-96321847 CTCTCCCGGCAGTCCCCAGCGGG + Intergenic
1132728824 16:1350713-1350735 TCCTGCCGACAGACCCCAGGAGG - Intronic
1132998788 16:2838802-2838824 TGCTCCTGACAGCCACCTCCAGG + Intronic
1133021814 16:2970148-2970170 CCCTCCCGCCAGCACCCAGCCGG + Intronic
1133209948 16:4258010-4258032 GGCTCCCTCCAGCCCCCAGAAGG + Exonic
1135764877 16:25168945-25168967 TGCTCCCGCCAGCACCGTGCTGG + Intronic
1136073590 16:27803405-27803427 TGGTGCCCCCAGCCCCCAGCAGG + Intronic
1137566750 16:49538103-49538125 AGCTCCTGACAGCCCCCACCAGG + Intronic
1137575679 16:49598550-49598572 CGCTGCTGACAGACCCCAGCTGG + Intronic
1137597516 16:49734581-49734603 TGCTGCAGACAGCCCCCAGGAGG - Intronic
1137617384 16:49855899-49855921 CGCTCCCCACAGCCGCCAACCGG - Intronic
1137686492 16:50390457-50390479 TGCTTCTCACAGCCCCCAGCTGG - Intergenic
1137773838 16:51039830-51039852 GGCTCCTCACTGCCCCCAGCAGG - Intergenic
1141125401 16:81397460-81397482 TTCTCCCGAGAGCCTCCAGGAGG + Intergenic
1141164109 16:81648904-81648926 TGTCCCCTAGAGCCCCCAGCAGG + Intronic
1141353591 16:83322224-83322246 TGCTCCAGAGAGACACCAGCCGG - Intronic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142499824 17:326050-326072 TGCTCTCGACAGGGCCCAGCAGG - Intronic
1142642938 17:1295255-1295277 TGCTCCCAGCTGTCCCCAGCTGG + Intronic
1142978209 17:3657453-3657475 GGGGCCAGACAGCCCCCAGCTGG - Intronic
1143001483 17:3797937-3797959 GGCTCCCCACTGCCCTCAGCAGG + Intronic
1143107295 17:4536135-4536157 GGCTCCCGGCGTCCCCCAGCAGG - Exonic
1144613992 17:16751837-16751859 TGCTCCCCACAGCCATCTGCTGG - Intronic
1144810178 17:17993929-17993951 CACTCCCAACAGCCCTCAGCAGG - Intronic
1145133654 17:20381889-20381911 TGCTCCCCACAGCCATCTGCTGG - Intergenic
1146009262 17:29180459-29180481 TTATCCCCACAGCCGCCAGCAGG - Intergenic
1146937965 17:36824273-36824295 TGCTCCCCACAGCCTCCTCCAGG + Intergenic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1150108811 17:62479685-62479707 TCCTCCCTGCAGCCCACAGCCGG - Intronic
1150225912 17:63524317-63524339 TGCACTCCTCAGCCCCCAGCAGG - Exonic
1152062759 17:78090742-78090764 TGCTGCCATCTGCCCCCAGCTGG - Intronic
1152417193 17:80170424-80170446 TGCTACCAACAGCAGCCAGCTGG - Intronic
1152644693 17:81463386-81463408 TGACTCCGACAGCCCCCAGAGGG + Intronic
1152865016 17:82717109-82717131 TGCTCCGGACAGTTCCCCGCAGG - Intronic
1153895068 18:9551404-9551426 TGCTCCTGCCAGCCACCATCTGG - Intronic
1155267941 18:24112090-24112112 TTCTCCCCACAGCCTCCAGAGGG - Intronic
1156387160 18:36615942-36615964 AGCTGCCAACAGCCACCAGCTGG + Intronic
1156636823 18:39041483-39041505 AGCTACCAACAGCACCCAGCTGG + Intergenic
1159573250 18:70144315-70144337 TGCTCCCAGAAGCCACCAGCTGG + Intronic
1160245628 18:77156564-77156586 TGCACGCCTCAGCCCCCAGCCGG - Intergenic
1160809689 19:1008016-1008038 GGCTCCCCACTGCCCCCAGGAGG - Intronic
1160835304 19:1122112-1122134 CCCTCCCGATTGCCCCCAGCAGG + Intronic
1160890132 19:1373366-1373388 TGCTGCCCACAGCGACCAGCTGG - Intronic
1160904302 19:1445326-1445348 TTCTCCCCGCAGCCGCCAGCGGG + Intergenic
1161200318 19:3010987-3011009 TGCTCCAGACAGGCACCAACAGG + Intronic
1161278674 19:3433598-3433620 TGTTCCCGTCAGCCCTGAGCTGG + Intronic
1162155809 19:8677400-8677422 TGGTGACCACAGCCCCCAGCAGG - Intergenic
1163266245 19:16224250-16224272 TGCACCCCACAGCACCCAGATGG - Intronic
1163664116 19:18595096-18595118 GGCTGCAGCCAGCCCCCAGCAGG + Intronic
1163851795 19:19668621-19668643 TGCTACCCACAGCCCCTCGCTGG - Intergenic
1164393878 19:27847285-27847307 TGCCCGCCACTGCCCCCAGCTGG + Intergenic
1166502919 19:43354371-43354393 TGGGCCCCACAGCCCCCAGCAGG + Exonic
925388414 2:3479395-3479417 TGCCGGCGACAGCCTCCAGCAGG - Exonic
925552954 2:5095875-5095897 TTCTCCCGGCAGCTCCCAGCCGG - Intergenic
925763604 2:7209963-7209985 GGCTCCCCACCGCCCTCAGCAGG - Intergenic
926053800 2:9761913-9761935 TGCTCCCCAAAACCCCCAGCTGG + Intergenic
926434472 2:12824257-12824279 TCCTCTCCACAGCCCCCAGAAGG - Intergenic
926694956 2:15764706-15764728 CACTGACGACAGCCCCCAGCAGG - Intergenic
927676758 2:25111858-25111880 TGCTCCCCAGAACCCCCAGAAGG + Intronic
927853361 2:26513496-26513518 ACCTCCCCGCAGCCCCCAGCAGG + Intronic
928425124 2:31171448-31171470 TGGTCCCGAAAACCCCTAGCTGG + Intergenic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
932321736 2:70827458-70827480 GGCTCCAGGTAGCCCCCAGCAGG - Intergenic
933278055 2:80303706-80303728 TGCTGCCCGCCGCCCCCAGCGGG - Exonic
935208586 2:100919485-100919507 TGCTCCCTACCGCCCCCAGCGGG - Intronic
937227741 2:120379339-120379361 TGCTTCAGGCAGCCCCCAACAGG + Intergenic
937298411 2:120823686-120823708 TCCTCTCCACAGCCCACAGCCGG - Intronic
938071276 2:128309740-128309762 AGCTCCCGACAGCCTGCACCTGG - Intronic
938371063 2:130768550-130768572 TGCCCCCTCCATCCCCCAGCAGG - Intergenic
944671233 2:201996100-201996122 TGCTCCCTCCATCCCCCACCGGG + Intergenic
945648876 2:212536776-212536798 TGAACCAGACAGCCCCCAGTAGG + Intronic
946161332 2:217837812-217837834 TGCTCCTGGCAGCCCCTGGCTGG - Intronic
946292188 2:218753769-218753791 CGCTCCCACCAACCCCCAGCTGG - Intronic
948070047 2:235113800-235113822 TTCACCGGACAGCCCCCACCGGG - Intergenic
948313758 2:237010841-237010863 TGTTCCCTCCAGTCCCCAGCTGG + Intergenic
948371904 2:237494988-237495010 TCCTCCCTCCAGCCTCCAGCTGG - Intronic
948699180 2:239749748-239749770 TGCTCCCAGCGGCCCCCAGGAGG - Intergenic
948740736 2:240044208-240044230 TCCTCCCTGCAGCCCCCACCTGG + Intergenic
948784582 2:240345713-240345735 TCTTCCCCACAGCCCCCAGGAGG - Intergenic
1169504024 20:6189074-6189096 TGCTCCTGTCAGCCACCACCAGG - Intergenic
1170840519 20:19921589-19921611 TGCTCCCAAACGCCCCCACCTGG - Intronic
1171034180 20:21703205-21703227 TGCTCCCGATCGCGCACAGCTGG + Intergenic
1171750383 20:29043430-29043452 TACCCCCAACATCCCCCAGCTGG - Intergenic
1172275031 20:33674588-33674610 TGCTCCCGACAGGCCGTCGCGGG - Intergenic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172979897 20:38933080-38933102 TGCTCATGTCAGCCCCAAGCAGG + Intronic
1173192223 20:40885486-40885508 TGCTCCCCCGACCCCCCAGCAGG + Intergenic
1173865916 20:46312646-46312668 TGCTCCCTACGCCCCCCGGCGGG - Intergenic
1173883504 20:46437115-46437137 TATTCACGACAGCCCCAAGCTGG + Intergenic
1175004352 20:55666405-55666427 TTCTCCCCACAGTCCCCAGCAGG - Intergenic
1176115170 20:63429059-63429081 TGCCGCCCACAGCCACCAGCAGG + Intronic
1178736978 21:35161349-35161371 TGCTCCCCACAGTCTCCATCTGG + Intronic
1179790150 21:43751732-43751754 TGCTCCCTCCAGCCCTCATCAGG + Intronic
1179791954 21:43760834-43760856 TGCGACAGAAAGCCCCCAGCAGG - Exonic
1179910451 21:44444627-44444649 TGCTCCACACTGCCCCCAGCGGG - Intergenic
1180188076 21:46150274-46150296 TTCTCCAGCCAGCCCCCAGGGGG - Intronic
1182516841 22:30863837-30863859 TGCTCCCCACTCCCCACAGCAGG - Intronic
1182960929 22:34474563-34474585 TGCTTCCTACTGCCCCTAGCAGG - Intergenic
1183343335 22:37294119-37294141 TGCTCCAGAAAGACACCAGCCGG + Intronic
950282528 3:11719880-11719902 CGCTCCCGAGAGGCGCCAGCGGG + Intronic
950456262 3:13094549-13094571 TCCTCCTGACACCCCCCACCTGG + Intergenic
952343998 3:32467682-32467704 TGCTTCAGCTAGCCCCCAGCAGG - Intronic
953907505 3:46875739-46875761 TGCTGCCCACAGCTCCCAGCAGG + Intronic
954706481 3:52483421-52483443 TGTTCCTGACTGCCGCCAGCAGG - Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
958583779 3:96060487-96060509 TGATCCAGACACCTCCCAGCAGG - Intergenic
960157198 3:114308015-114308037 TGCTCTCCACAGAGCCCAGCAGG - Exonic
963851016 3:150210653-150210675 TGCTTCCTACAGGCCCCTGCAGG - Intergenic
967217085 3:187220023-187220045 TGCTACTGACTGCCCACAGCTGG + Intronic
968620477 4:1601517-1601539 TGCGCCCCCCAGCCCCCACCTGG + Intergenic
969143058 4:5096668-5096690 TGTTCGCGACTGGCCCCAGCAGG - Intronic
969158833 4:5237312-5237334 TGCACCCAACAGTCCCCTGCAGG - Intronic
969263364 4:6047464-6047486 TGCACCTGATAGCCACCAGCCGG + Intronic
971330468 4:25677316-25677338 TGCTCCCCACATTCCCCATCAGG + Exonic
971734124 4:30424247-30424269 TTTGCCCCACAGCCCCCAGCAGG + Intergenic
974757217 4:66225490-66225512 TCCTCCCTACAGTCCCCAGAAGG - Intergenic
976771905 4:88662256-88662278 GGCTCCTGACAGATCCCAGCTGG - Intronic
978545962 4:109873026-109873048 TGCTGCTGGCAGCACCCAGCAGG - Intergenic
982436035 4:155383954-155383976 TGCTCCTGCCAGCCCCCCACAGG - Intergenic
986290065 5:6392711-6392733 TTCTCCCCGCAGCCCCCAGAAGG - Intergenic
989671981 5:43928711-43928733 TGCTCCCCACAACCCCCAACAGG - Intergenic
994025336 5:95074950-95074972 AGCTCCCGACAGAGCCAAGCTGG - Intronic
995960092 5:117829407-117829429 TGTTCCCCACACCACCCAGCTGG - Intergenic
998892764 5:146764193-146764215 AGGTCCCTACAGCCCACAGCTGG - Intronic
999291618 5:150429632-150429654 TGACCTCCACAGCCCCCAGCAGG - Intergenic
1001812330 5:174638455-174638477 TGTTCCTGACAGCCCACAGGTGG + Intergenic
1003429337 6:6024687-6024709 TGCTCCTCACAGCCCTCAGAAGG - Intergenic
1006316900 6:33296733-33296755 TCCTCCCGACGGCTCCGAGCTGG - Exonic
1008131205 6:47721515-47721537 AGGGCCCTACAGCCCCCAGCTGG - Exonic
1010202961 6:73299162-73299184 TGCCACCGACAGCACGCAGCTGG + Intronic
1011797927 6:90978032-90978054 TCCTCCCCACAGCCTCCAGAAGG + Intergenic
1012460275 6:99453020-99453042 TGCTCCCGCCACCCCACAACAGG - Intronic
1012550929 6:100464496-100464518 CGCTCGCGACAGCCCCTCGCAGG + Intronic
1012935138 6:105359625-105359647 TGCTCCCAACACCCATCAGCTGG - Intronic
1014246733 6:119078299-119078321 TCTTCCCAACAGACCCCAGCCGG + Exonic
1015965387 6:138692398-138692420 TGCTCCCGCCCGCCCCCTGGCGG - Intronic
1017324517 6:153130748-153130770 CCCTCCCGGCCGCCCCCAGCAGG + Intronic
1018645166 6:165941521-165941543 TGATCCCGACATCCCCCACCGGG - Intronic
1018758137 6:166867153-166867175 TGCTCACCTCATCCCCCAGCTGG - Intronic
1019459982 7:1152752-1152774 TGCTCCCCGCAGCCCTCAGAAGG + Intronic
1022814951 7:33905035-33905057 TGCGCCCGGGCGCCCCCAGCGGG + Exonic
1023970232 7:44985576-44985598 CTCTTCCCACAGCCCCCAGCAGG - Intergenic
1024250976 7:47505476-47505498 CGCTCCACACAGCCCCCAGGAGG + Intronic
1025033007 7:55572449-55572471 GGCTCCCGCCCGCTCCCAGCCGG - Exonic
1026634483 7:72069454-72069476 TGCTCCCTAGAGCCTCCAGAGGG - Intronic
1027129324 7:75579965-75579987 TCCTCCCCACATCTCCCAGCAGG - Intronic
1029513643 7:101012605-101012627 TGCTCCCAACAGCCCCCTCTCGG + Intronic
1029714392 7:102318036-102318058 CGATCCCAACAGCACCCAGCTGG + Intronic
1029942442 7:104494852-104494874 TGCTTCACACAACCCCCAGCTGG + Intronic
1033552264 7:142458231-142458253 AGCTCCCCACAGGCTCCAGCAGG + Intergenic
1033554528 7:142477180-142477202 AGCTCCCCACAGGCTCCAGCAGG + Intergenic
1033556806 7:142495285-142495307 AGCTCCCAACAGGCTCCAGCAGG + Intergenic
1033559153 7:142514724-142514746 AGCTCCCCACAGGCTCCAGCAGG + Intergenic
1037813094 8:22098166-22098188 TGCTCCTGCCAGGCCCCAGCTGG + Exonic
1038723433 8:30058536-30058558 TGCTCCCAACACCTCCCACCAGG - Intergenic
1039822595 8:41146976-41146998 AGCTCCAGACATCCACCAGCAGG + Intergenic
1040979327 8:53229536-53229558 TGCTCCCCAGAGCCTCCACCAGG + Exonic
1042265705 8:66907224-66907246 TGCCCCCGCCAACCCCCAACAGG + Intronic
1042784892 8:72536685-72536707 TCCTCCCGCCCGCCCACAGCAGG - Intergenic
1044257538 8:90082905-90082927 TTATCCCGACGGCCCCAAGCCGG + Intronic
1047533793 8:125700828-125700850 TGCCCTCCACTGCCCCCAGCAGG + Intergenic
1049120141 8:140729272-140729294 AACTCCCAACACCCCCCAGCTGG + Intronic
1049276637 8:141723395-141723417 TGCCCCAGGCAGCCCCAAGCAGG + Intergenic
1049329402 8:142042326-142042348 TGCTCAGGACAGATCCCAGCTGG - Intergenic
1049590855 8:143461574-143461596 TATTCACGACAGCCCCCAACTGG + Intronic
1053721466 9:40951119-40951141 TGCCCCCACCATCCCCCAGCTGG - Intergenic
1054344530 9:63901049-63901071 TGCCCCCACCATCCCCCAGCTGG + Intergenic
1056874858 9:90318470-90318492 TGGTCCTGACTGCCTCCAGCAGG + Intergenic
1057619113 9:96619442-96619464 GGCTCCCGCCAGCCCCGCGCGGG + Exonic
1059295876 9:113270122-113270144 TACTCCTTCCAGCCCCCAGCTGG - Intronic
1061122305 9:128651090-128651112 TGGTCCCCACTGCACCCAGCAGG - Intronic
1061419783 9:130466861-130466883 TGGCTCAGACAGCCCCCAGCAGG - Intronic
1061823080 9:133239257-133239279 TGCTCACCAGCGCCCCCAGCTGG - Intergenic
1061884904 9:133586540-133586562 AGCTCCCCCCAGACCCCAGCTGG + Intergenic
1062031601 9:134364492-134364514 TGCTCCCAGCAGCCACCAGAGGG + Intronic
1062374283 9:136255004-136255026 TTCTTCCGAAGGCCCCCAGCAGG + Intergenic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1186399378 X:9242600-9242622 TGCTAACGACAGCTCACAGCTGG + Intergenic
1188056646 X:25548847-25548869 TGATCCCGTCACCTCCCAGCAGG + Intergenic
1189122261 X:38407391-38407413 TGCTCCCGAGATCCCCCTCCAGG - Intronic
1189529605 X:41866018-41866040 TGCTCCCAACTGGCCCCAGCAGG - Intronic
1191162102 X:57340789-57340811 TTCTCCCAACATCCCCCAACAGG - Intronic
1192260799 X:69504995-69505017 TGCCCCGCACCGCCCCCAGCCGG + Intergenic
1195272960 X:103251114-103251136 TCCTCCGCACAGCCCCCAGAGGG - Intergenic
1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG + Intergenic