ID: 1113913622

View in Genome Browser
Species Human (GRCh38)
Location 13:113856829-113856851
Sequence CCGTCCCTGCAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113913622_1113913624 23 Left 1113913622 13:113856829-113856851 CCTCTCTGCTTCTGCAGGGACGG 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1113913624 13:113856875-113856897 AACAATGTTGACTCAGAGAGTGG 0: 1
1: 0
2: 0
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113913622 Original CRISPR CCGTCCCTGCAGAAGCAGAG AGG (reversed) Intronic
901431043 1:9215184-9215206 CCAACCCTGGAGGAGCAGAGGGG + Intergenic
902325456 1:15697241-15697263 CCGTCCCAGCAGTAGAAGAATGG + Intronic
902553211 1:17231436-17231458 CCGTCCCAGCAGTGGAAGAGTGG - Intronic
904256873 1:29259858-29259880 TCTTCCCTGCAGCGGCAGAGCGG + Exonic
904340607 1:29831750-29831772 CCATCCATGCTGAAGCAGGGGGG + Intergenic
904722832 1:32523537-32523559 AGGGCCCTCCAGAAGCAGAGCGG + Intronic
907012854 1:50978911-50978933 CAGCACCTGCAGAAGCACAGTGG + Intergenic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
911474147 1:98355750-98355772 CTGCCCCTGCAGACGCAGGGAGG - Intergenic
915916217 1:159942422-159942444 GTGTCCCTGGAAAAGCAGAGAGG + Intronic
918282681 1:183022747-183022769 CGGTCCCTGGAGAATCAGAAGGG - Intergenic
920070137 1:203296758-203296780 CCCTCCCAGCAGCAGGAGAGTGG + Intergenic
922124775 1:222711976-222711998 CTGTCCCTGCGGAGGCGGAGAGG + Intronic
922702099 1:227767223-227767245 CCCTCCCTGCAGCTGCCGAGTGG - Intronic
923685182 1:236148671-236148693 CCATCCCTGCTGCAGCTGAGTGG - Intronic
1065225002 10:23534508-23534530 CCGTGCAGGCAGAAGCAGTGGGG - Intergenic
1066460436 10:35608213-35608235 CCCTCCATCCGGAAGCAGAGCGG + Exonic
1069546177 10:69330499-69330521 CAGTACCTGCAGAACCAGAACGG + Intronic
1069726870 10:70585781-70585803 CAGGCCCTGCAGCAGCTGAGGGG + Intergenic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1072708043 10:97696314-97696336 CTGTTCCTGCAGAAGCATAATGG - Intergenic
1076004268 10:126935488-126935510 ACGTCCCAGCAGCAGCACAGAGG - Intronic
1076196028 10:128519008-128519030 CCTTCCCTGCCTCAGCAGAGGGG - Intergenic
1076859243 10:133132802-133132824 CCTTCCCCGCAGAACCAGTGGGG - Intergenic
1077117747 11:892997-893019 CTCTCCCTCCAGAGGCAGAGAGG - Intronic
1078107448 11:8367435-8367457 CAGTACCTAAAGAAGCAGAGAGG - Intergenic
1081149874 11:39614992-39615014 TCGGCTCTGCAGGAGCAGAGCGG + Intergenic
1083747161 11:64742938-64742960 CTGTCCCGGGAGAGGCAGAGCGG + Intronic
1084857148 11:71996596-71996618 CCCTCCCTGCCTAAGCAGGGTGG + Exonic
1085221234 11:74875342-74875364 ACTCCCCTGCAGAGGCAGAGTGG + Intronic
1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG + Intronic
1086952109 11:92901206-92901228 CTGTCCCTGGACAGGCAGAGAGG - Intergenic
1088494224 11:110417543-110417565 CCGCCAATGCAGAAGCAGACAGG - Intergenic
1089047278 11:115513167-115513189 CTTTCCGTGCAGAAGCAGAGGGG + Intergenic
1091001098 11:131911210-131911232 CCTTCCCGGCGGAAGCAGCGAGG + Intronic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1091912355 12:4242742-4242764 CTGTGCCTGCAGGAGCAGACTGG + Intergenic
1092071761 12:5637053-5637075 CCCACCCTGCAGCAGAAGAGGGG - Intronic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1098179190 12:67828024-67828046 ACATCACTGCAGGAGCAGAGTGG + Intergenic
1101957085 12:109221507-109221529 CCCTTCTTTCAGAAGCAGAGAGG + Intronic
1102074428 12:110048501-110048523 CCAGCCCTGCAGAAGCAGAGAGG + Intronic
1103905463 12:124325327-124325349 ACGGCCCTGCAGGAGCAGGGCGG - Exonic
1104575648 12:129963719-129963741 CCTTCCCTGCAGGAGCCGAGAGG + Intergenic
1104953066 12:132451105-132451127 CCCTCCCTGCAGAAGCCGGGCGG - Intergenic
1106120234 13:26853975-26853997 CCCTGCCTGGAGAAGCAGAAAGG + Intergenic
1108067612 13:46594475-46594497 GTCTCCCTGCAGAAGCAAAGAGG + Intronic
1112494576 13:99894975-99894997 CCGTCCCTGGAGGAGAGGAGGGG - Exonic
1113311684 13:109139456-109139478 CGGTCCCTGGAGATGCAGTGGGG - Intronic
1113473337 13:110561946-110561968 CCGGCTGTGCAGAAGCGGAGGGG - Intergenic
1113529256 13:111008573-111008595 CCGTCACAGCACAAGCAGACTGG - Intergenic
1113751487 13:112779444-112779466 CTGTCCCAGCTGAAGCACAGCGG - Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1115456646 14:33611999-33612021 CTGGCCCTGCAGATGCTGAGTGG + Intronic
1119616967 14:76105142-76105164 CCCTCCCTGGTGAGGCAGAGAGG + Intergenic
1121324004 14:93009332-93009354 CCGTCCACACACAAGCAGAGGGG + Intronic
1122481526 14:102050418-102050440 GGTTACCTGCAGAAGCAGAGGGG - Exonic
1124783728 15:32659638-32659660 CCTGCCCTGCAGAAGCCCAGGGG + Intronic
1125771694 15:42171902-42171924 CTTTGCCTTCAGAAGCAGAGGGG + Intronic
1126670406 15:51110698-51110720 CCTGCCCTGCACAAGCAGTGGGG + Intergenic
1127673729 15:61220537-61220559 CCGCCCTTCCAGAAGCAAAGAGG - Intronic
1127981360 15:64037657-64037679 CTGTCCCTTCAGAAGCTGAGTGG + Intronic
1128613442 15:69091440-69091462 CTGTCCCTCTGGAAGCAGAGAGG + Intergenic
1129144366 15:73633495-73633517 CCGCCCCTGCAGAGGCTGATTGG + Intronic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1131123434 15:89837791-89837813 CTTTTCCTGCAGCAGCAGAGTGG + Intronic
1133148494 16:3808461-3808483 CCATCAGTGCAGAGGCAGAGGGG + Intronic
1133223778 16:4330524-4330546 CCCTCCCTGCAGAGGCCTAGAGG - Intronic
1135271691 16:21075110-21075132 CAGTCCCGTCAGAAGCACAGGGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1137386784 16:48049400-48049422 ACTTCCCTGCACCAGCAGAGTGG + Intergenic
1139440913 16:66966401-66966423 CATCCCCTGCAGGAGCAGAGGGG + Intronic
1139601484 16:67990121-67990143 CCGCCCCTGCAGAAGAAGAACGG - Exonic
1140469317 16:75205669-75205691 CTGTCCCTGAAGCAGCCGAGGGG + Intronic
1140472467 16:75223270-75223292 CTGTCCCTGAAGCAGCCGAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141184032 16:81774425-81774447 CCCTACCTCCAGAAGCAGTGAGG + Intronic
1141185308 16:81782842-81782864 CCCACCCTGCAGCATCAGAGGGG + Intronic
1141620511 16:85234751-85234773 CCGCCCCCGCAGCAGCAGGGAGG + Intergenic
1141951027 16:87339495-87339517 CAGCCCCTGCAGAAGAGGAGAGG + Intronic
1143320137 17:6063034-6063056 GGGTCACTGGAGAAGCAGAGTGG - Intronic
1143782537 17:9236808-9236830 CAGTGCCTGGAGAAGCACAGGGG + Intronic
1143805186 17:9420442-9420464 TCCTCCCTGGAGAAGGAGAGGGG - Intronic
1144160620 17:12554040-12554062 TCATCCCTGCAGCAGCACAGGGG - Intergenic
1145010079 17:19362924-19362946 CCGTCCCCGCCGAAGCGCAGAGG + Intronic
1146794858 17:35773810-35773832 CCCTCCCTGCAGTGTCAGAGTGG + Intronic
1147369130 17:39979817-39979839 CCTTCCCTGCAGAACCAGTGGGG + Intergenic
1151535796 17:74738166-74738188 CCAACCCTGCAGAGGAAGAGTGG - Intronic
1151830058 17:76544338-76544360 CCTTCCCTTCAGAGGCAGAGTGG - Intronic
1151945846 17:77319488-77319510 CCGTCCCCGCCCAGGCAGAGAGG - Intronic
1152067968 17:78121876-78121898 CCCTCCCTCCAGGCGCAGAGAGG + Intronic
1153473455 18:5471065-5471087 CCTGCCATGCAGGAGCAGAGTGG + Intronic
1153746983 18:8189424-8189446 CTGTCCATGGAGATGCAGAGTGG - Intronic
1156499830 18:37550673-37550695 CCTCCCCTGCTGCAGCAGAGAGG - Intronic
1160137624 18:76286046-76286068 CCCTCCCTGCAGAAGCACAAAGG + Intergenic
1161046359 19:2136848-2136870 TCCTCCCAGCAGACGCAGAGAGG - Intronic
1161937446 19:7380900-7380922 CGGGCCCTGCAGGATCAGAGGGG - Exonic
1162337890 19:10072932-10072954 CCATCCCTGCAGAAGCCCAGTGG + Intergenic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163372115 19:16907107-16907129 CCCACCCTGCAGGAGGAGAGAGG - Exonic
1164547715 19:29182991-29183013 CCTACTCGGCAGAAGCAGAGAGG - Intergenic
1164931067 19:32176643-32176665 CCTACCTTGCAGGAGCAGAGAGG - Intergenic
1164983105 19:32628740-32628762 CAGTCATCGCAGAAGCAGAGAGG + Exonic
1165601451 19:37058417-37058439 CAGTCCATCCAGAAGCAGAGGGG - Intronic
1166301159 19:41912927-41912949 CCGGCCCTGCAGAGGCCGGGAGG + Intronic
925733254 2:6938008-6938030 ATGGCCCTGCAGAGGCAGAGGGG + Intronic
925770934 2:7282584-7282606 AGGTCCCTGCAGAAGCAGTGTGG + Intergenic
926441891 2:12897655-12897677 CCTTCCCTTCAAAATCAGAGTGG + Intergenic
927703953 2:25285751-25285773 CCCTCCCTGCTTAAGCAAAGAGG + Intronic
931797930 2:65729521-65729543 CAGGCCCTACATAAGCAGAGAGG + Intergenic
933639262 2:84741684-84741706 CCCTCCCTGGAGCAGCACAGTGG + Intronic
935106607 2:100050784-100050806 CTGCCCCTGCAGATGCAGATGGG + Intronic
935418272 2:102841319-102841341 CGTCCCCTGCAGAAGCACAGGGG + Intronic
935796602 2:106647826-106647848 CAGTCCCTGCACAAGAAGAAAGG - Intergenic
936913488 2:117616092-117616114 CAGTACTGGCAGAAGCAGAGTGG - Intergenic
937551625 2:123099977-123099999 CCATCCATACTGAAGCAGAGGGG - Intergenic
938257222 2:129868718-129868740 TCCTCCCTCCAGAAGGAGAGCGG + Intergenic
938370062 2:130763123-130763145 GGGTCCCTGCAGGGGCAGAGGGG - Exonic
945895104 2:215472544-215472566 CTCTCCCTGAAAAAGCAGAGTGG + Intergenic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947751116 2:232532962-232532984 CCGGCCCTGCAGCAGCCGAGAGG - Intronic
948451995 2:238081443-238081465 CCGTCTCCGTAGAAGCAGAAAGG + Intronic
948694723 2:239727430-239727452 CCTCCCCTCCAGAAGCACAGTGG - Intergenic
949044811 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG + Intergenic
1168956496 20:1837898-1837920 CCCTCCCTGCAGAATCAGTGAGG - Intergenic
1169558233 20:6770543-6770565 CCGTCCCTGTAGAGGCAGCTTGG + Intronic
1171164341 20:22957207-22957229 ATGTCCCTGCAGAGGCTGAGAGG + Intergenic
1171933954 20:31256129-31256151 TCCTCCCTGCAGAATCTGAGGGG + Intergenic
1172051218 20:32120608-32120630 GCATCCCTGAAGAAGCATAGGGG - Intronic
1172604837 20:36207314-36207336 TAGTCCCTGAAGAAGCTGAGGGG + Intronic
1173197361 20:40926651-40926673 CCCTCCCAGCAGATGCAGCGTGG - Intergenic
1174186614 20:48710785-48710807 CTGTTCCTGCAGACGCAGTGTGG - Intronic
1174869228 20:54168048-54168070 GTGTCCCTGCAGAAGAAGTGCGG - Intronic
1177215514 21:18123308-18123330 CCGTATCTACAGGAGCAGAGTGG - Intronic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180848958 22:19001919-19001941 CCTTCCCTTTAGAAGCAAAGAGG + Intergenic
1181664150 22:24379782-24379804 CCTTCCCTTTAGAAGCAAAGAGG + Intronic
1182511965 22:30826318-30826340 CCTTCCCTGCACCTGCAGAGTGG + Intronic
1182667832 22:31972255-31972277 CTGTCCCTGGAGCAGAAGAGTGG + Intergenic
1183410839 22:37654220-37654242 CCGTCCCTCCAGAAGCCCAGAGG + Intronic
1183762310 22:39832967-39832989 CAGTCTGTGCAGAAGCCGAGTGG + Intronic
1184090936 22:42292769-42292791 CCGGCCCTGGAGGCGCAGAGGGG - Intronic
1184263334 22:43332438-43332460 GAGTCCGTGTAGAAGCAGAGGGG + Intronic
1184468508 22:44682796-44682818 GCGGCCCTGCAGAATGAGAGCGG - Intronic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
1185275946 22:49950308-49950330 CCCGCCCTGCAGTAGCACAGGGG + Intergenic
949089483 3:10980-11002 CCCTCTCTGCAGGCGCAGAGAGG + Intergenic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
954699476 3:52443806-52443828 TCGTCCCTGGAGAGGCTGAGGGG - Intronic
955932170 3:64068030-64068052 CACTCCCTGGAGGAGCAGAGTGG + Intergenic
956720666 3:72114875-72114897 CAGGCCCTGCAGAAGCAGAATGG - Intergenic
958529594 3:95309532-95309554 CAGGCCCTGCAGAAGCAGCTAGG - Intergenic
959593275 3:108102235-108102257 CCCACCCTGCAGAGACAGAGTGG + Intergenic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
963917892 3:150876772-150876794 CAGTCCCTGAAAAATCAGAGTGG + Intronic
966371175 3:179252128-179252150 ACGTCCCTGCAGATGAACAGCGG + Intronic
966875977 3:184321895-184321917 CCGTAGCTGGAGTAGCAGAGGGG - Exonic
969567937 4:7991200-7991222 CCTTCTCTGCAGATGCTGAGAGG + Intronic
969692561 4:8711621-8711643 CTGTCCCTGAAGCAGCAGTGTGG - Intergenic
969827740 4:9771364-9771386 AGGTCACTGCAGAAGGAGAGAGG + Intronic
971259598 4:25044063-25044085 CGGTCCCTGCAGCACCTGAGTGG - Intergenic
971491042 4:27212236-27212258 CAGACCCTGCTTAAGCAGAGTGG - Intergenic
976605205 4:86976182-86976204 CTTTCCATGCAGAAGCACAGAGG + Intronic
985267116 4:188160573-188160595 CCCTGGCTCCAGAAGCAGAGAGG - Intergenic
985506326 5:283109-283131 TCGTAGCTGCAGAATCAGAGAGG + Intronic
985874916 5:2587189-2587211 CCAGTCCTGCAGAACCAGAGAGG + Intergenic
990447076 5:55903360-55903382 CCTTCCTTGAAGAAGCAGGGAGG - Intronic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
990714555 5:58622372-58622394 CAGTCCCTGCAGAATCAGTGAGG + Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991295183 5:65073061-65073083 CCGTGCATGGAGAAGCAGATGGG - Intergenic
992332353 5:75730284-75730306 CAGTGCCTGCATCAGCAGAGTGG - Intergenic
1001313885 5:170629472-170629494 CAAGGCCTGCAGAAGCAGAGAGG + Intronic
1002717759 5:181239066-181239088 CCTTGCCTCCAGAAGCACAGAGG + Exonic
1003050970 6:2781144-2781166 CCGTCCATGCACATACAGAGCGG + Intronic
1007662897 6:43497244-43497266 ACGTCCCTGGGGAAGGAGAGTGG + Intronic
1015732200 6:136360760-136360782 GCGTTCGTGAAGAAGCAGAGAGG - Exonic
1016289043 6:142507266-142507288 CCGCGACTGCAGTAGCAGAGGGG + Intergenic
1019307801 7:344163-344185 TCAGCCCTGCAGAAGCCGAGTGG + Intergenic
1019382367 7:730727-730749 CTCTCCCTCCAGCAGCAGAGTGG + Intronic
1019536509 7:1532116-1532138 CCCACCCTGGAGAATCAGAGGGG - Intronic
1019611733 7:1940178-1940200 CCTTCCCAGGAGAAGCACAGAGG - Intronic
1019660531 7:2221382-2221404 CGTTCCCTCCAGAAGCAGATAGG + Intronic
1019739533 7:2665836-2665858 CCGTCCTTCCAGAAGCAGCATGG + Intergenic
1020122631 7:5513615-5513637 CCGCCGAGGCAGAAGCAGAGCGG + Intronic
1021033082 7:15762916-15762938 CCTTGCCTGCAGAACCAAAGAGG - Intergenic
1022138143 7:27468494-27468516 CAGTCCCTGCAGCTGTAGAGTGG - Intergenic
1023851016 7:44150408-44150430 CAGTCCCTACAGAGACAGAGAGG - Intronic
1023999867 7:45183140-45183162 TAGTACCTGCAAAAGCAGAGGGG - Exonic
1026694102 7:72575412-72575434 TCGTCCTTGGAGAATCAGAGTGG + Exonic
1027190219 7:75992227-75992249 CCCTCCCAGCAGAGGCCGAGGGG - Exonic
1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG + Intronic
1028459142 7:91071698-91071720 CCCTCCCTGAAGGAGCACAGAGG - Intronic
1029681620 7:102115360-102115382 GTGTCCCTGCAGCAGCACAGAGG - Intronic
1032271013 7:130405924-130405946 CAGACACCGCAGAAGCAGAGAGG + Intronic
1032492828 7:132336911-132336933 AAGTCCACGCAGAAGCAGAGTGG - Intronic
1032528063 7:132594790-132594812 CAGTGCCTGAAGAAGCAGACTGG - Intronic
1032785482 7:135196559-135196581 CAGGCCCTGCTGAAGGAGAGGGG + Intronic
1033145839 7:138869439-138869461 CAGGCCCTGCAGTAGCAGAGGGG + Intronic
1033273901 7:139956827-139956849 AGGGCCCTGCAGAGGCAGAGAGG - Intronic
1034268809 7:149793549-149793571 CCAGCCCTGCAGAGGCACAGAGG - Intergenic
1039891480 8:41688584-41688606 ACTTCCCTGCAGAAGAAGAAAGG + Exonic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1056221424 9:84453773-84453795 CCTTTCCTGTAAAAGCAGAGAGG + Intergenic
1056817333 9:89811496-89811518 CCGTCACTGCAGAAGCTGGGTGG + Intergenic
1057184292 9:93048206-93048228 CCTGCCCTGCATGAGCAGAGGGG + Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1058611116 9:106776742-106776764 CCCTCCTAGCAGGAGCAGAGAGG - Intergenic
1060055310 9:120408175-120408197 CTGTTCCTTCAGAAGAAGAGTGG + Intronic
1060308714 9:122439891-122439913 CCGTGCATAGAGAAGCAGAGAGG + Intergenic
1060935090 9:127510020-127510042 CCGTCCCTGTAGACGGGGAGGGG - Intronic
1062075955 9:134590103-134590125 CCGGCCAGGCAAAAGCAGAGGGG + Intergenic
1062280607 9:135750081-135750103 TGGACCCTGAAGAAGCAGAGAGG - Exonic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1186155154 X:6717583-6717605 TCGTCCCTGCTGAAGGGGAGAGG - Intergenic
1187682451 X:21781002-21781024 TCATCCCTACAAAAGCAGAGTGG + Intergenic
1190561165 X:51686685-51686707 CCCTCTCTGCTGAAGCAGAAAGG + Intergenic
1190563126 X:51706632-51706654 CCCTCTCTGCTGAAGCAGAAAGG - Intergenic