ID: 1113917719

View in Genome Browser
Species Human (GRCh38)
Location 13:113884235-113884257
Sequence ACGCTGGCGTGAATCTACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917719_1113917722 -7 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917722 13:113884251-113884273 CCAGCGTCTCCCTTGAGGCCAGG No data
1113917719_1113917729 22 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917729 13:113884280-113884302 CATAGGAGAGTGATTCCTCTGGG No data
1113917719_1113917723 -1 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917723 13:113884257-113884279 TCTCCCTTGAGGCCAGGCTCTGG No data
1113917719_1113917726 5 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917726 13:113884263-113884285 TTGAGGCCAGGCTCTGGCATAGG No data
1113917719_1113917730 25 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917730 13:113884283-113884305 AGGAGAGTGATTCCTCTGGGAGG No data
1113917719_1113917731 30 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917719_1113917728 21 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917728 13:113884279-113884301 GCATAGGAGAGTGATTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917719 Original CRISPR ACGCTGGCGTGAATCTACCC CGG (reversed) Intergenic