ID: 1113917725

View in Genome Browser
Species Human (GRCh38)
Location 13:113884261-113884283
Sequence TATGCCAGAGCCTGGCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917725_1113917733 6 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917733 13:113884290-113884312 TGATTCCTCTGGGAGGTCCGGGG No data
1113917725_1113917735 19 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917735 13:113884303-113884325 AGGTCCGGGGTCCCGAGCCCCGG No data
1113917725_1113917738 28 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917738 13:113884312-113884334 GTCCCGAGCCCCGGGAATGCCGG No data
1113917725_1113917736 20 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917736 13:113884304-113884326 GGTCCGGGGTCCCGAGCCCCGGG No data
1113917725_1113917732 5 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917732 13:113884289-113884311 GTGATTCCTCTGGGAGGTCCGGG No data
1113917725_1113917728 -5 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917728 13:113884279-113884301 GCATAGGAGAGTGATTCCTCTGG No data
1113917725_1113917731 4 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917725_1113917729 -4 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917729 13:113884280-113884302 CATAGGAGAGTGATTCCTCTGGG No data
1113917725_1113917730 -1 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917730 13:113884283-113884305 AGGAGAGTGATTCCTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917725 Original CRISPR TATGCCAGAGCCTGGCCTCA AGG (reversed) Intergenic