ID: 1113917727

View in Genome Browser
Species Human (GRCh38)
Location 13:113884269-113884291
Sequence CACTCTCCTATGCCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917727_1113917736 12 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917736 13:113884304-113884326 GGTCCGGGGTCCCGAGCCCCGGG No data
1113917727_1113917742 27 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917742 13:113884319-113884341 GCCCCGGGAATGCCGGCTGAGGG No data
1113917727_1113917733 -2 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917733 13:113884290-113884312 TGATTCCTCTGGGAGGTCCGGGG No data
1113917727_1113917741 26 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917741 13:113884318-113884340 AGCCCCGGGAATGCCGGCTGAGG No data
1113917727_1113917735 11 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917735 13:113884303-113884325 AGGTCCGGGGTCCCGAGCCCCGG No data
1113917727_1113917731 -4 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917727_1113917730 -9 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917730 13:113884283-113884305 AGGAGAGTGATTCCTCTGGGAGG No data
1113917727_1113917744 28 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917744 13:113884320-113884342 CCCCGGGAATGCCGGCTGAGGGG No data
1113917727_1113917732 -3 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917732 13:113884289-113884311 GTGATTCCTCTGGGAGGTCCGGG No data
1113917727_1113917738 20 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917738 13:113884312-113884334 GTCCCGAGCCCCGGGAATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917727 Original CRISPR CACTCTCCTATGCCAGAGCC TGG (reversed) Intergenic