ID: 1113917731

View in Genome Browser
Species Human (GRCh38)
Location 13:113884288-113884310
Sequence AGTGATTCCTCTGGGAGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917721_1113917731 14 Left 1113917721 13:113884251-113884273 CCAGCGTCTCCCTTGAGGCCAGG No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917725_1113917731 4 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917719_1113917731 30 Left 1113917719 13:113884235-113884257 CCGGGGTAGATTCACGCCAGCGT No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917724_1113917731 5 Left 1113917724 13:113884260-113884282 CCCTTGAGGCCAGGCTCTGGCAT No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data
1113917727_1113917731 -4 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917731 13:113884288-113884310 AGTGATTCCTCTGGGAGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917731 Original CRISPR AGTGATTCCTCTGGGAGGTC CGG Intergenic