ID: 1113917733

View in Genome Browser
Species Human (GRCh38)
Location 13:113884290-113884312
Sequence TGATTCCTCTGGGAGGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917727_1113917733 -2 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917733 13:113884290-113884312 TGATTCCTCTGGGAGGTCCGGGG No data
1113917725_1113917733 6 Left 1113917725 13:113884261-113884283 CCTTGAGGCCAGGCTCTGGCATA No data
Right 1113917733 13:113884290-113884312 TGATTCCTCTGGGAGGTCCGGGG No data
1113917724_1113917733 7 Left 1113917724 13:113884260-113884282 CCCTTGAGGCCAGGCTCTGGCAT No data
Right 1113917733 13:113884290-113884312 TGATTCCTCTGGGAGGTCCGGGG No data
1113917721_1113917733 16 Left 1113917721 13:113884251-113884273 CCAGCGTCTCCCTTGAGGCCAGG No data
Right 1113917733 13:113884290-113884312 TGATTCCTCTGGGAGGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917733 Original CRISPR TGATTCCTCTGGGAGGTCCG GGG Intergenic