ID: 1113917734

View in Genome Browser
Species Human (GRCh38)
Location 13:113884295-113884317
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917734_1113917748 22 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917734_1113917741 0 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917741 13:113884318-113884340 AGCCCCGGGAATGCCGGCTGAGG No data
1113917734_1113917744 2 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917744 13:113884320-113884342 CCCCGGGAATGCCGGCTGAGGGG No data
1113917734_1113917742 1 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917742 13:113884319-113884341 GCCCCGGGAATGCCGGCTGAGGG No data
1113917734_1113917738 -6 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917738 13:113884312-113884334 GTCCCGAGCCCCGGGAATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917734 Original CRISPR CGGGACCCCGGACCTCCCAG AGG (reversed) Intergenic