ID: 1113917737

View in Genome Browser
Species Human (GRCh38)
Location 13:113884307-113884329
Sequence ATTCCCGGGGCTCGGGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917737_1113917748 10 Left 1113917737 13:113884307-113884329 CCGGGGTCCCGAGCCCCGGGAAT No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917737_1113917744 -10 Left 1113917737 13:113884307-113884329 CCGGGGTCCCGAGCCCCGGGAAT No data
Right 1113917744 13:113884320-113884342 CCCCGGGAATGCCGGCTGAGGGG No data
1113917737_1113917752 28 Left 1113917737 13:113884307-113884329 CCGGGGTCCCGAGCCCCGGGAAT No data
Right 1113917752 13:113884358-113884380 CACGGAACCCTCATGCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917737 Original CRISPR ATTCCCGGGGCTCGGGACCC CGG (reversed) Intergenic