ID: 1113917741

View in Genome Browser
Species Human (GRCh38)
Location 13:113884318-113884340
Sequence AGCCCCGGGAATGCCGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917734_1113917741 0 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917741 13:113884318-113884340 AGCCCCGGGAATGCCGGCTGAGG No data
1113917727_1113917741 26 Left 1113917727 13:113884269-113884291 CCAGGCTCTGGCATAGGAGAGTG No data
Right 1113917741 13:113884318-113884340 AGCCCCGGGAATGCCGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917741 Original CRISPR AGCCCCGGGAATGCCGGCTG AGG Intergenic