ID: 1113917748

View in Genome Browser
Species Human (GRCh38)
Location 13:113884340-113884362
Sequence GGGCACGCGACCCCTCTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113917745_1113917748 -4 Left 1113917745 13:113884321-113884343 CCCGGGAATGCCGGCTGAGGGGC No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917740_1113917748 2 Left 1113917740 13:113884315-113884337 CCGAGCCCCGGGAATGCCGGCTG No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917746_1113917748 -5 Left 1113917746 13:113884322-113884344 CCGGGAATGCCGGCTGAGGGGCA No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917737_1113917748 10 Left 1113917737 13:113884307-113884329 CCGGGGTCCCGAGCCCCGGGAAT No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917734_1113917748 22 Left 1113917734 13:113884295-113884317 CCTCTGGGAGGTCCGGGGTCCCG No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917739_1113917748 3 Left 1113917739 13:113884314-113884336 CCCGAGCCCCGGGAATGCCGGCT No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data
1113917743_1113917748 -3 Left 1113917743 13:113884320-113884342 CCCCGGGAATGCCGGCTGAGGGG No data
Right 1113917748 13:113884340-113884362 GGGCACGCGACCCCTCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113917748 Original CRISPR GGGCACGCGACCCCTCTTCA CGG Intergenic