ID: 1113921813

View in Genome Browser
Species Human (GRCh38)
Location 13:113917596-113917618
Sequence CCCGCAGAGACAGCAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113921801_1113921813 21 Left 1113921801 13:113917552-113917574 CCCCCTTATCAATCATCACTGAG No data
Right 1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG No data
1113921804_1113921813 18 Left 1113921804 13:113917555-113917577 CCTTATCAATCATCACTGAGACC No data
Right 1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG No data
1113921802_1113921813 20 Left 1113921802 13:113917553-113917575 CCCCTTATCAATCATCACTGAGA No data
Right 1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG No data
1113921807_1113921813 -3 Left 1113921807 13:113917576-113917598 CCTCAGCAGAATGAGAGGGCCCC No data
Right 1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG No data
1113921803_1113921813 19 Left 1113921803 13:113917554-113917576 CCCTTATCAATCATCACTGAGAC No data
Right 1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113921813 Original CRISPR CCCGCAGAGACAGCAGGCAG GGG Intergenic
No off target data available for this crispr