ID: 1113922123

View in Genome Browser
Species Human (GRCh38)
Location 13:113919140-113919162
Sequence CGACCCATTGGGTTATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113922112_1113922123 9 Left 1113922112 13:113919108-113919130 CCAGCCCAGCCCACAGCTGCCGC No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922110_1113922123 21 Left 1113922110 13:113919096-113919118 CCAAGTATGAGCCCAGCCCAGCC No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922116_1113922123 -1 Left 1113922116 13:113919118-113919140 CCACAGCTGCCGCGCAGCCCTGC No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922117_1113922123 -10 Left 1113922117 13:113919127-113919149 CCGCGCAGCCCTGCGACCCATTG No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922113_1113922123 5 Left 1113922113 13:113919112-113919134 CCCAGCCCACAGCTGCCGCGCAG No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922115_1113922123 0 Left 1113922115 13:113919117-113919139 CCCACAGCTGCCGCGCAGCCCTG No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922114_1113922123 4 Left 1113922114 13:113919113-113919135 CCAGCCCACAGCTGCCGCGCAGC No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data
1113922111_1113922123 10 Left 1113922111 13:113919107-113919129 CCCAGCCCAGCCCACAGCTGCCG No data
Right 1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113922123 Original CRISPR CGACCCATTGGGTTATAAGG TGG Intergenic
No off target data available for this crispr