ID: 1113923355

View in Genome Browser
Species Human (GRCh38)
Location 13:113927058-113927080
Sequence TGACCTCACTCCAGAGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113923355_1113923358 -8 Left 1113923355 13:113927058-113927080 CCTTCAACTCTGGAGTGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1113923358 13:113927073-113927095 TGAGGTCAGATCTTGGCTCTGGG 0: 1
1: 0
2: 1
3: 30
4: 245
1113923355_1113923359 -7 Left 1113923355 13:113927058-113927080 CCTTCAACTCTGGAGTGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1113923359 13:113927074-113927096 GAGGTCAGATCTTGGCTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 263
1113923355_1113923360 13 Left 1113923355 13:113927058-113927080 CCTTCAACTCTGGAGTGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1113923360 13:113927094-113927116 GGGCCACCACCAGCTGTTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 162
1113923355_1113923357 -9 Left 1113923355 13:113927058-113927080 CCTTCAACTCTGGAGTGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1113923357 13:113927072-113927094 GTGAGGTCAGATCTTGGCTCTGG 0: 1
1: 0
2: 0
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113923355 Original CRISPR TGACCTCACTCCAGAGTTGA AGG (reversed) Intergenic