ID: 1113925622

View in Genome Browser
Species Human (GRCh38)
Location 13:113940021-113940043
Sequence GTGGCAGCCGTGATCAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113925616_1113925622 -10 Left 1113925616 13:113940008-113940030 CCAGGATGCCCGGGTGGCAGCCG No data
Right 1113925622 13:113940021-113940043 GTGGCAGCCGTGATCAGGGGAGG No data
1113925607_1113925622 27 Left 1113925607 13:113939971-113939993 CCTGTCTGTCATGTGTGTGGGCT No data
Right 1113925622 13:113940021-113940043 GTGGCAGCCGTGATCAGGGGAGG No data
1113925604_1113925622 30 Left 1113925604 13:113939968-113939990 CCTCCTGTCTGTCATGTGTGTGG No data
Right 1113925622 13:113940021-113940043 GTGGCAGCCGTGATCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113925622 Original CRISPR GTGGCAGCCGTGATCAGGGG AGG Intergenic
No off target data available for this crispr