ID: 1113927685

View in Genome Browser
Species Human (GRCh38)
Location 13:113950676-113950698
Sequence GCCAGCCCTGGTGCACACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113927685_1113927702 28 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG No data
1113927685_1113927700 22 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927700 13:113950721-113950743 GGGCAGCTTTCTCCCACAGCTGG No data
1113927685_1113927689 -6 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927689 13:113950693-113950715 GCTGGCCCCGCCTCTCCTGCAGG No data
1113927685_1113927701 23 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927701 13:113950722-113950744 GGCAGCTTTCTCCCACAGCTGGG No data
1113927685_1113927704 30 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927704 13:113950729-113950751 TTCTCCCACAGCTGGGTCTGGGG No data
1113927685_1113927695 2 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927695 13:113950701-113950723 CGCCTCTCCTGCAGGGCCCTGGG No data
1113927685_1113927703 29 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927685_1113927690 -5 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927690 13:113950694-113950716 CTGGCCCCGCCTCTCCTGCAGGG No data
1113927685_1113927694 1 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927694 13:113950700-113950722 CCGCCTCTCCTGCAGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113927685 Original CRISPR GCCAGCCCTGGTGCACACAG GGG (reversed) Intergenic