ID: 1113927688

View in Genome Browser
Species Human (GRCh38)
Location 13:113950688-113950710
Sequence AGGAGAGGCGGGGCCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113927688_1113927703 17 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927688_1113927704 18 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927704 13:113950729-113950751 TTCTCCCACAGCTGGGTCTGGGG No data
1113927688_1113927700 10 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927700 13:113950721-113950743 GGGCAGCTTTCTCCCACAGCTGG No data
1113927688_1113927707 27 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927688_1113927701 11 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927701 13:113950722-113950744 GGCAGCTTTCTCCCACAGCTGGG No data
1113927688_1113927695 -10 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927695 13:113950701-113950723 CGCCTCTCCTGCAGGGCCCTGGG No data
1113927688_1113927702 16 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113927688 Original CRISPR AGGAGAGGCGGGGCCAGCCC TGG (reversed) Intergenic
No off target data available for this crispr