ID: 1113927697

View in Genome Browser
Species Human (GRCh38)
Location 13:113950708-113950730
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113927697_1113927708 13 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927708 13:113950744-113950766 GTCTGGGGTTCAGCAGGAGCCGG No data
1113927697_1113927703 -3 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927697_1113927711 23 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927711 13:113950754-113950776 CAGCAGGAGCCGGCGCCCAGGGG No data
1113927697_1113927701 -9 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927701 13:113950722-113950744 GGCAGCTTTCTCCCACAGCTGGG No data
1113927697_1113927709 21 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927709 13:113950752-113950774 TTCAGCAGGAGCCGGCGCCCAGG No data
1113927697_1113927702 -4 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG No data
1113927697_1113927707 7 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927697_1113927710 22 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927710 13:113950753-113950775 TCAGCAGGAGCCGGCGCCCAGGG No data
1113927697_1113927700 -10 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927700 13:113950721-113950743 GGGCAGCTTTCTCCCACAGCTGG No data
1113927697_1113927704 -2 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927704 13:113950729-113950751 TTCTCCCACAGCTGGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113927697 Original CRISPR AAAGCTGCCCAGGGCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr