ID: 1113927703

View in Genome Browser
Species Human (GRCh38)
Location 13:113950728-113950750
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113927687_1113927703 27 Left 1113927687 13:113950678-113950700 CCTGTGTGCACCAGGGCTGGCCC No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927697_1113927703 -3 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927686_1113927703 28 Left 1113927686 13:113950677-113950699 CCCTGTGTGCACCAGGGCTGGCC No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927693_1113927703 5 Left 1113927693 13:113950700-113950722 CCGCCTCTCCTGCAGGGCCCTGG No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927688_1113927703 17 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927692_1113927703 6 Left 1113927692 13:113950699-113950721 CCCGCCTCTCCTGCAGGGCCCTG No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927696_1113927703 2 Left 1113927696 13:113950703-113950725 CCTCTCCTGCAGGGCCCTGGGCA No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927685_1113927703 29 Left 1113927685 13:113950676-113950698 CCCCTGTGTGCACCAGGGCTGGC No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data
1113927691_1113927703 7 Left 1113927691 13:113950698-113950720 CCCCGCCTCTCCTGCAGGGCCCT No data
Right 1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113927703 Original CRISPR TTTCTCCCACAGCTGGGTCT GGG Intergenic
No off target data available for this crispr