ID: 1113927707

View in Genome Browser
Species Human (GRCh38)
Location 13:113950738-113950760
Sequence AGCTGGGTCTGGGGTTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113927698_1113927707 -2 Left 1113927698 13:113950717-113950739 CCCTGGGCAGCTTTCTCCCACAG No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927691_1113927707 17 Left 1113927691 13:113950698-113950720 CCCCGCCTCTCCTGCAGGGCCCT No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927688_1113927707 27 Left 1113927688 13:113950688-113950710 CCAGGGCTGGCCCCGCCTCTCCT No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927692_1113927707 16 Left 1113927692 13:113950699-113950721 CCCGCCTCTCCTGCAGGGCCCTG No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927696_1113927707 12 Left 1113927696 13:113950703-113950725 CCTCTCCTGCAGGGCCCTGGGCA No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927693_1113927707 15 Left 1113927693 13:113950700-113950722 CCGCCTCTCCTGCAGGGCCCTGG No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927697_1113927707 7 Left 1113927697 13:113950708-113950730 CCTGCAGGGCCCTGGGCAGCTTT No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data
1113927699_1113927707 -3 Left 1113927699 13:113950718-113950740 CCTGGGCAGCTTTCTCCCACAGC No data
Right 1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113927707 Original CRISPR AGCTGGGTCTGGGGTTCAGC AGG Intergenic
No off target data available for this crispr