ID: 1113931822

View in Genome Browser
Species Human (GRCh38)
Location 13:113972776-113972798
Sequence CACCAGGGCCTTCTTGCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113931815_1113931822 -2 Left 1113931815 13:113972755-113972777 CCTGGCAGGGACCCAGGCCCTCA No data
Right 1113931822 13:113972776-113972798 CACCAGGGCCTTCTTGCAAACGG No data
1113931812_1113931822 7 Left 1113931812 13:113972746-113972768 CCCAGAGCTCCTGGCAGGGACCC No data
Right 1113931822 13:113972776-113972798 CACCAGGGCCTTCTTGCAAACGG No data
1113931808_1113931822 25 Left 1113931808 13:113972728-113972750 CCTTGCTGGTGGGTGAGGCCCAG No data
Right 1113931822 13:113972776-113972798 CACCAGGGCCTTCTTGCAAACGG No data
1113931813_1113931822 6 Left 1113931813 13:113972747-113972769 CCAGAGCTCCTGGCAGGGACCCA No data
Right 1113931822 13:113972776-113972798 CACCAGGGCCTTCTTGCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113931822 Original CRISPR CACCAGGGCCTTCTTGCAAA CGG Intergenic
No off target data available for this crispr