ID: 1113932193

View in Genome Browser
Species Human (GRCh38)
Location 13:113974350-113974372
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 2, 1: 4, 2: 2, 3: 13, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113932181_1113932193 20 Left 1113932181 13:113974307-113974329 CCCGCAGGCCGGGGCTGGGGCGG 0: 5
1: 3
2: 9
3: 94
4: 731
Right 1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG 0: 2
1: 4
2: 2
3: 13
4: 201
1113932185_1113932193 12 Left 1113932185 13:113974315-113974337 CCGGGGCTGGGGCGGGTTCTGCG 0: 5
1: 2
2: 1
3: 28
4: 322
Right 1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG 0: 2
1: 4
2: 2
3: 13
4: 201
1113932183_1113932193 19 Left 1113932183 13:113974308-113974330 CCGCAGGCCGGGGCTGGGGCGGG 0: 4
1: 3
2: 10
3: 106
4: 891
Right 1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG 0: 2
1: 4
2: 2
3: 13
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113932193 Original CRISPR CTTTCCCGCAGGCCGGGGTT GGG Intergenic
900640325 1:3685301-3685323 CGTTCCAGCAGGCGGGGGCTCGG - Intronic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
905819851 1:40980412-40980434 CCTTCCCGGCGGCCGGGGGTCGG + Intronic
906200798 1:43958936-43958958 CATTCCCACAGGTGGGGGTTGGG - Intronic
912166180 1:107044997-107045019 CCTTCCCGCAGGTCAGGGCTCGG + Intergenic
912312853 1:108641001-108641023 CCTTCCCGCAGGGCAGGGCTCGG - Intronic
914203408 1:145506002-145506024 CCTTCCCGCGGGGCGGGGCTCGG - Intergenic
914482530 1:148079156-148079178 CCTTCCCGCGGGGCGGGGCTCGG - Intergenic
915424232 1:155810980-155811002 CTGTCACGCAGGCTGGAGTTCGG - Intronic
916018212 1:160769248-160769270 CTTTCCCACAGTTCTGGGTTTGG - Intergenic
916455291 1:164965017-164965039 CTTCCCAGCAGGCTGGGTTTAGG - Intergenic
918349122 1:183635660-183635682 CTTTGCCGCTGGTCGGGATTGGG - Exonic
918659739 1:187073948-187073970 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
921010318 1:211134242-211134264 GTCTCCCGCAGGCCGGCGGTGGG - Intergenic
921983646 1:221285790-221285812 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
923573841 1:235140522-235140544 CCTTCCCGCAGGGCAGGGTTCGG + Intronic
923954124 1:238995550-238995572 CTTTCGCCCAGGCCGGACTTCGG + Intergenic
924940671 1:248810954-248810976 CCCTCCTGCAGGACGGGGTTAGG - Exonic
1063344596 10:5299221-5299243 CTGACCCACAGGCCTGGGTTTGG + Intergenic
1063769722 10:9183578-9183600 CCTTCCCGCAGGGCAGGGGTTGG + Intergenic
1066235440 10:33480600-33480622 CCTCCCCGCAGGGCAGGGTTCGG - Intergenic
1067694094 10:48523244-48523266 CTATCCAGCAGGCCAGGGTGGGG + Intronic
1068374050 10:56155351-56155373 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1070987224 10:80699575-80699597 CCTTCCTGCTGGCCAGGGTTAGG + Intergenic
1072533642 10:96343009-96343031 CTTACCAGCAGCCCTGGGTTAGG + Intergenic
1076014193 10:127014787-127014809 CTCTCCCGGAGGCCAGGGCTGGG + Intronic
1077332389 11:1989313-1989335 CTTCCCAGCAGGCCGGTGTGCGG - Intergenic
1077412159 11:2408685-2408707 CTGCCCCGCAGGCTGGGGTGGGG - Intronic
1079407102 11:20156786-20156808 CTGCCCCGAAGGGCGGGGTTGGG + Intronic
1079555400 11:21753273-21753295 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1080450480 11:32374912-32374934 CCTTCCCCGAGGCTGGGGTTTGG - Intergenic
1080858797 11:36135332-36135354 CTTTCCCCATGGCTGGGGTTTGG + Intronic
1081597981 11:44472398-44472420 CTTTCCCTCAGGCTGGAGTGTGG - Intergenic
1083227499 11:61294352-61294374 CTTTCCCCCGGGCCGCGGTGGGG - Intronic
1083441378 11:62678830-62678852 CACACCCGCAGGCCGGGGTTGGG + Intronic
1083812026 11:65111656-65111678 CTTCCCCGCAGGCAGGTGTCAGG + Exonic
1084165926 11:67374687-67374709 CCTTCCCGCAGGCCTGGGTTGGG + Intronic
1202815370 11_KI270721v1_random:44489-44511 CTTCCCAGCAGGCCGGTGTGCGG - Intergenic
1093972985 12:25391657-25391679 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1094817847 12:34204657-34204679 CTTTCGAGCAGGCTGGGGTAAGG - Intergenic
1097416057 12:59317846-59317868 CTTTCCTGCAGGCAGGTGATTGG + Intergenic
1101036096 12:100708142-100708164 CTTTCTTGCAGTCTGGGGTTTGG + Intergenic
1103853315 12:123947189-123947211 CCTTCCCGCAGGGCAGGGCTCGG + Intronic
1103949344 12:124542655-124542677 CTTCCCTGCAGGCTGGAGTTTGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1111441931 13:88292048-88292070 CCTTCCCGCGGGGCAGGGTTCGG + Intergenic
1111644602 13:91015421-91015443 CTGTCACCCAGGCTGGGGTTTGG - Intergenic
1111748350 13:92296894-92296916 CCTTCCCGCAGGGCAGGGCTCGG + Intronic
1112247454 13:97747727-97747749 CCTCCCCGGAGGCCTGGGTTGGG - Intergenic
1113932138 13:113974162-113974184 CTTTCCTGCAGGCCGGGGCTGGG + Intergenic
1113932151 13:113974209-113974231 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932179 13:113974303-113974325 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932207 13:113974397-113974419 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932221 13:113974444-113974466 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1115272143 14:31564561-31564583 CTGTCCCCCAGGCTGGAGTTGGG - Intronic
1119027794 14:71167723-71167745 CCTCCCCGCAGGCCGGGCTCGGG + Intergenic
1120844188 14:89111876-89111898 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1121409710 14:93741305-93741327 CTTTCCCAAGGGCCGGGGTTGGG + Intronic
1122961240 14:105094417-105094439 CTGTCCCCCAGGCCCAGGTTGGG + Intergenic
1125565728 15:40677059-40677081 CCTTCCCGCGGGGCAGGGTTCGG - Intergenic
1125872445 15:43114466-43114488 CTGTCCCGCAGGCTGGAGTGCGG + Intronic
1131222935 15:90600329-90600351 CTATCCTGCAGGCCTGGGCTGGG - Intronic
1131250267 15:90825698-90825720 CTTCCCCGCAGGGCAGGGCTTGG + Intergenic
1131679911 15:94710498-94710520 CTTTCTCCCAGGCCGGAGTGCGG + Intergenic
1131810572 15:96169023-96169045 CGGTTCCGCAGGCTGGGGTTGGG - Intergenic
1132309927 15:100849915-100849937 CTCTCCCGCAGGCTGCGGGTGGG - Intergenic
1133287909 16:4699009-4699031 CTGGCCCTCAGCCCGGGGTTGGG - Intronic
1133909338 16:10050727-10050749 TTTTTCCACAGACCGGGGTTGGG - Intronic
1134680596 16:16122274-16122296 CTTTCTGCAAGGCCGGGGTTTGG - Intronic
1134891474 16:17845182-17845204 CATTGCAGCAGGCCGGGGTAGGG + Intergenic
1136556480 16:31010463-31010485 CTGTGCCGGAGGCCGGGGTCTGG + Exonic
1138077154 16:54053760-54053782 GTTTCTCGAAGGCAGGGGTTTGG - Intronic
1139510799 16:67427519-67427541 CTGTCACGCAGGCTGGGGTGCGG + Intergenic
1140679954 16:77375343-77375365 CTTTCACCCAGGCCGGAGTGCGG - Intronic
1141892837 16:86938520-86938542 CTTTACAGCAGGCCAGGGTTTGG + Intergenic
1141952186 16:87346243-87346265 TTTGCCCGCAGGCCGGGGCCAGG + Intronic
1142656946 17:1400501-1400523 CTTTTCCGCAGGTCGGGCCTCGG - Intergenic
1143102066 17:4509957-4509979 CTTTCCTGGAGGCTGAGGTTTGG - Intronic
1143116270 17:4583498-4583520 CTTTCAGGCAGGCCAGGCTTGGG + Intergenic
1143582252 17:7834262-7834284 CCTTCTCCCAGGCCGGGGCTGGG - Intergenic
1144731029 17:17526446-17526468 CTTCCACGCTGGCCGGGGATCGG - Intronic
1145249132 17:21287918-21287940 CTTTCCGACAGCCAGGGGTTGGG - Intronic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1149037334 17:52149536-52149558 ATTTCCAGCAGTCAGGGGTTGGG - Intronic
1150031998 17:61748314-61748336 CTTTTCCACAGACCTGGGTTGGG - Intronic
1150255614 17:63741890-63741912 CTTCCCCGCAGGGCGGGGTGGGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152541377 17:80978301-80978323 CTGTCACGCAGGCTGGGGTGCGG - Intergenic
1152926870 17:83091358-83091380 CTTTCCGCCAGGCAGGGGTGAGG - Intronic
1155935238 18:31746447-31746469 CTTTCCTGGAGGATGGGGTTGGG + Intergenic
1156863679 18:41865986-41866008 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1158697235 18:59714224-59714246 CTTTCCCGCGGGGCAGGGCTCGG - Intergenic
1159952786 18:74496868-74496890 CTTTCCCGGAGACCTGGGGTGGG + Intronic
1160522083 18:79513568-79513590 CTTTCCCGCCGGCGGGGGCGTGG + Intronic
1163276936 19:16290809-16290831 CTTTCCGGCGGCCTGGGGTTGGG - Intergenic
1165771959 19:38385370-38385392 CTATCCAGCAGTCTGGGGTTCGG + Intronic
1165823462 19:38692246-38692268 CTTTGCCCCTGGCTGGGGTTGGG + Intronic
1165838025 19:38771128-38771150 CTCCCCTGCAGGCCGTGGTTGGG - Exonic
1165841540 19:38791569-38791591 CTCCCCTGCAGGCCGTGGTTGGG + Exonic
929233733 2:39585584-39585606 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
929510515 2:42562696-42562718 CTTTCCCTGGGGCCAGGGTTTGG + Intronic
933132625 2:78691256-78691278 CTTTCACCCAGGCTGGGGTGCGG - Intergenic
933712142 2:85334544-85334566 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
938628699 2:133140907-133140929 CTTTCCTTCAGGCAGGGATTAGG + Intronic
944255780 2:197622339-197622361 CTTTCACTCAGGCTGGGGTGCGG + Intronic
946358062 2:219201559-219201581 CCTTCCCGCCGGGCAGGGTTCGG - Intronic
947720445 2:232366569-232366591 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
948525712 2:238569763-238569785 CTGTCCTGAGGGCCGGGGTTAGG - Intergenic
1169354168 20:4893894-4893916 CTTTCCCGCAGGCTGGTGGGAGG - Intronic
1171823376 20:29874946-29874968 CCTTTCCGCAGGCAGGGGTGGGG - Intergenic
1171896721 20:30815362-30815384 CCTTTCAGCAGGCCGGGGTGGGG + Intergenic
1172126309 20:32627127-32627149 CTTCCCCGGAGGCCGGGGGAGGG - Intergenic
1172411829 20:34730102-34730124 CTGTCCCCCAGGCTGGGGTGTGG + Intronic
1173750371 20:45470858-45470880 CTTTCCCGCAGGGCAGGCTTCGG - Intronic
1174315609 20:49698284-49698306 CTGTCCCCCAGGCCGGAGTGTGG - Intronic
1175210090 20:57348625-57348647 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1175965512 20:62658283-62658305 CTCTCCCACAGGCCGGGATTTGG - Intronic
1176868456 21:14069813-14069835 CCTTCCAGCAGGCTGGGGTAGGG - Intergenic
1177945827 21:27468671-27468693 CTGTCCCCCAGGCCGGAGTGCGG - Intergenic
1181647174 22:24238190-24238212 CTGTCCCCCAGGCTGGGGTGTGG - Intronic
1184606134 22:45575856-45575878 CTTCTCCGCAGGCCAGGGATAGG - Intronic
1185258711 22:49849894-49849916 CCTGCCCGCATGCAGGGGTTTGG + Intergenic
1185380981 22:50507488-50507510 CACTCACGCAGTCCGGGGTTGGG - Intronic
950513343 3:13447328-13447350 CCTTCCCGCAGGGCAGGGTTCGG - Intergenic
951055463 3:18142042-18142064 CTTTCGCCCAGGCCGGAGTGCGG - Intronic
953350289 3:42210160-42210182 CTTTCCCGGAGGCAGAGTTTTGG + Intronic
954041026 3:47887435-47887457 CTTTCCCGCGGGGCAGGGCTCGG + Intronic
954620153 3:51990801-51990823 CCTTCCCGCGGGTCAGGGTTTGG + Intergenic
954839227 3:53495896-53495918 CTTCCACGCCGGCCGGGGCTGGG + Intronic
956764427 3:72472457-72472479 TTTTCCCACAGACCGGGGTTGGG - Intergenic
957459473 3:80497797-80497819 CTTTCACGTATGCAGGGGTTAGG + Intergenic
960560018 3:119073534-119073556 CCTTCCCGCAGGGCAGGGATCGG - Intronic
961387422 3:126530322-126530344 CTTTCCAGCAGGCTGTGGTCTGG + Intronic
961454708 3:127018189-127018211 CTTTCCCACAGGCAGGTGTTGGG + Intronic
962754335 3:138456753-138456775 TTTTCCCACAGACCGGGGGTGGG - Intronic
963440430 3:145333607-145333629 CCTTCCCGCGGGGCGGGGCTGGG + Intergenic
964014405 3:151928384-151928406 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
965044109 3:163552453-163552475 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
965837394 3:172867011-172867033 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
966886761 3:184381300-184381322 GCTGCCCACAGGCCGGGGTTGGG - Exonic
967018058 3:185498969-185498991 CTGCCCCGCGGGCCGGGGTGCGG - Exonic
968804417 4:2763256-2763278 CATTCCCGCGGGGCGGGGCTCGG - Intergenic
970272135 4:14358849-14358871 CCTTCCCGCAGGGCAGGGCTTGG + Intergenic
973190289 4:47378182-47378204 CCTTCCCGCGGGGCAGGGTTCGG - Intronic
979308346 4:119174015-119174037 CCTTCCCGCAGGGCAGGGCTTGG + Intronic
983926533 4:173408953-173408975 CTTTCGCCCAGGCCGGAGTGCGG - Intergenic
984265681 4:177495821-177495843 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
984874709 4:184356880-184356902 CTATCCCACAGGCTGGGGCTGGG - Intergenic
986912360 5:12574075-12574097 CCTTCCCGCGGGGCAGGGTTCGG - Intergenic
987532759 5:19142901-19142923 CCTTCCCGCAGGGCAGGGCTTGG - Intergenic
987543855 5:19287974-19287996 CCTTCCCGCAGGGCAGGGCTTGG + Intergenic
991330214 5:65485605-65485627 CCTTCCCGCAGGGCAGGGCTGGG - Intergenic
991984954 5:72275761-72275783 TTTCCCCACTGGCCGGGGTTGGG + Intronic
992296761 5:75333915-75333937 CCTTCCCGCAGGGCAGGGTTCGG + Intergenic
994701675 5:103142165-103142187 CCTTCCCGCAGGGCAGGGCTCGG - Intronic
995326395 5:110894157-110894179 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
996107068 5:119517334-119517356 CCTTCCCGCAGGGCAGGGCTCGG + Intronic
997755768 5:136398064-136398086 CTTCCCTGCAGGTCGGGGTCTGG + Intergenic
1000066059 5:157694068-157694090 CCTTCCCGCAGGGCAGGGCTGGG + Intergenic
1001831597 5:174793801-174793823 CCTTCCCGCAGGCCCGGGGCTGG + Intergenic
1002570371 5:180136504-180136526 CTTGCCCGTAGGCCCGGGTCCGG - Exonic
1003170825 6:3720895-3720917 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1003581467 6:7344446-7344468 CCTTCCCGCAGGGCAGGATTCGG + Intronic
1004126937 6:12883139-12883161 CTCTCCCTCAGGCAGGGGCTGGG - Intronic
1006354354 6:33545770-33545792 CTTTCCTGCTTGCCGAGGTTGGG - Intergenic
1006932926 6:37698371-37698393 TTTTCCTGCTGGGCGGGGTTGGG - Intronic
1013048056 6:106507452-106507474 CTTTCCCACAGGCCTGGGCAGGG - Intergenic
1013459129 6:110358357-110358379 CTCCCCCGCGGGCCGGGGTGCGG + Intergenic
1014516711 6:122387752-122387774 TTTTACCAGAGGCCGGGGTTGGG + Intergenic
1015572226 6:134633674-134633696 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1019562093 7:1664408-1664430 TGTTCCTGCAGGACGGGGTTGGG - Intergenic
1019612857 7:1945753-1945775 CTGGGCCGCAGACCGGGGTTAGG + Intronic
1020567056 7:9810982-9811004 CTTTCCCCCAGGCTGGAGTGAGG - Intergenic
1023049757 7:36240785-36240807 TTTTTCCGCAGACCTGGGTTGGG + Intronic
1023966055 7:44963591-44963613 CTTTCCCACAAGACGGGGGTAGG - Intronic
1026639705 7:72113555-72113577 CTACCCCGCAGGCCAGGGGTTGG + Intronic
1027561695 7:79739531-79739553 CTTTCCCGCGGGGCAGGGCTCGG + Intergenic
1029241820 7:99168545-99168567 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1029378888 7:100199708-100199730 TTATCCCCCAGGCTGGGGTTAGG + Intronic
1034155040 7:148949311-148949333 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1034253940 7:149714494-149714516 CTTTCCCAGAGGCCGCGGTCGGG - Intergenic
1034967099 7:155398322-155398344 CCTTCCCGCAGGGCAGGGCTTGG - Intergenic
1037374581 8:18213848-18213870 CTCTCGCCCAGGCCGGGGTGCGG + Intronic
1037563523 8:20096381-20096403 CTGTCCCGCAGGCTGGAGTGCGG + Intergenic
1037756010 8:21710497-21710519 GTTTCCAGCAGGCTGGGGTATGG - Intronic
1038799429 8:30735800-30735822 CTGTCCCCCAGGCTGGGGTGCGG - Intronic
1039284885 8:36029056-36029078 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1043110125 8:76169800-76169822 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1043129912 8:76447744-76447766 CCTTCCCGCGGGGCAGGGTTCGG - Intergenic
1044633453 8:94300464-94300486 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1045063356 8:98426593-98426615 GTTTCCCGAAGCCCGGGGGTGGG - Intronic
1048757476 8:137755251-137755273 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1049173549 8:141177088-141177110 CACACCCGCAGGCCGGAGTTGGG + Intronic
1049861613 8:144902430-144902452 CTTCCCCACAGGGCGGGGCTGGG + Intergenic
1050920635 9:11197095-11197117 CGTTCCCGCAGGGCAGGGCTCGG + Intergenic
1053749355 9:41236667-41236689 CCTTTCAGCAGGCCGGGGTGGGG + Intergenic
1054254792 9:62801544-62801566 CCTTTCAGCAGGCCGGGGTGTGG + Intergenic
1054336512 9:63814058-63814080 CCTTTCAGCAGGCCGGGGTGGGG - Intergenic
1057260409 9:93579949-93579971 CTGCCCCGCTGGCCTGGGTTGGG + Intronic
1057511155 9:95680560-95680582 CCTTCCCGCAGGGCAGGGTTTGG + Intergenic
1057596337 9:96418495-96418517 CTTTCCAGCCGGCCGGGGCGGGG + Intergenic
1057907169 9:98992236-98992258 CCTTCCCGCAGGGCAGGGCTTGG - Intronic
1058890327 9:109355652-109355674 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1060815253 9:126631817-126631839 CTTACCCGGAGGCAGGGGTCTGG - Intronic
1061302894 9:129716085-129716107 CATTCCCACCGGCCGGGTTTGGG - Intronic
1061483849 9:130910351-130910373 CCTTCCCGCGGGCCAGGGCTCGG + Intronic
1185609833 X:1387648-1387670 CAGTCCCAGAGGCCGGGGTTAGG + Intronic
1186785111 X:12949895-12949917 CTTTCCTGCAGGAAGGGGGTAGG - Intergenic
1187904033 X:24049921-24049943 CCTTCCCGCAGGACAGGGCTCGG + Intergenic
1189235833 X:39486457-39486479 CTTTACAGCAGACCAGGGTTTGG + Intergenic
1190045850 X:47111135-47111157 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1190243554 X:48676378-48676400 CTTTCCCGGAGCCCGGGCTCTGG + Intergenic
1191618614 X:63192703-63192725 CCTTCCTGCAGGGCAGGGTTCGG - Intergenic
1192273404 X:69605741-69605763 CCTTCCCGCAGGCATGGGCTTGG + Intergenic
1193268919 X:79506757-79506779 CTTTCCTCCAGGCCAGGGCTGGG + Intergenic
1196319512 X:114270692-114270714 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1199824835 X:151488738-151488760 CTTTGCCCCAGGACAGGGTTAGG - Intergenic
1200133486 X:153863718-153863740 CATCCTCCCAGGCCGGGGTTGGG - Intronic
1200550330 Y:4571076-4571098 CCTTCCCGCAGGGCAGGGCTTGG + Intergenic