ID: 1113933007

View in Genome Browser
Species Human (GRCh38)
Location 13:113978267-113978289
Sequence CGGGGTGCAGACGTCCCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113933007_1113933015 27 Left 1113933007 13:113978267-113978289 CCTGGAGGGACGTCTGCACCCCG 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1113933015 13:113978317-113978339 TCTTCCCTTCTTTGATTTTCTGG 0: 1
1: 2
2: 4
3: 64
4: 588
1113933007_1113933016 30 Left 1113933007 13:113978267-113978289 CCTGGAGGGACGTCTGCACCCCG 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1113933016 13:113978320-113978342 TCCCTTCTTTGATTTTCTGGAGG 0: 1
1: 1
2: 14
3: 303
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113933007 Original CRISPR CGGGGTGCAGACGTCCCTCC AGG (reversed) Exonic
900481015 1:2899348-2899370 GGGTGTGCAGACGGCCCTCTGGG - Intergenic
900542809 1:3212541-3212563 TGGGGTGCAGGCGTCCAGCCAGG - Intronic
901302951 1:8212829-8212851 CCGGGCTCAGACATCCCTCCTGG - Intergenic
902686034 1:18078251-18078273 TGGGATGCAGATGTCCCTTCTGG + Intergenic
903855866 1:26337264-26337286 CGAGTTGCTGACCTCCCTCCGGG - Exonic
904237526 1:29124480-29124502 CGGGGTGCGGATGTGCCGCCGGG + Intergenic
908624736 1:66027873-66027895 CAGGGTACAGCCCTCCCTCCTGG + Intronic
916167740 1:161978593-161978615 CGGTATCCAGGCGTCCCTCCTGG + Intergenic
921809563 1:219497223-219497245 TGGGGTGCAGATCTTCCTCCTGG + Intergenic
923568376 1:235093359-235093381 AGGGGTGGGGACGTCCCGCCGGG - Intergenic
1066011852 10:31201743-31201765 AGGGGTGCAGACATCTCTCAGGG - Intergenic
1066473879 10:35725653-35725675 CGTGGTGCAAATGTCCCTGCTGG - Intergenic
1075715818 10:124554679-124554701 CGAGGTGCAGACAGCCCACCTGG - Intronic
1076725261 10:132410167-132410189 CGGTGTGCAGGTGTCGCTCCTGG + Intronic
1076855924 10:133115621-133115643 CGGGGTCCTGGCCTCCCTCCTGG - Intronic
1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG + Intergenic
1084004225 11:66314731-66314753 TGGGGTGCAGACCCCCCTCATGG - Exonic
1084768477 11:71327390-71327412 TGGGGTGCAGACGTGCAGCCTGG - Intergenic
1089172900 11:116527706-116527728 GGGGGTGTAGAGGTCCTTCCTGG - Intergenic
1092406858 12:8227541-8227563 CAGGGTGCACACATCCCTGCAGG + Exonic
1103309184 12:119990294-119990316 CGAGGTGAGGACCTCCCTCCAGG + Exonic
1104035892 12:125096905-125096927 GGGGGTGAAGACTTCTCTCCTGG + Intronic
1104983277 12:132583247-132583269 CGGGGTGCAGGCCGCCCGCCGGG - Exonic
1105211137 13:18257877-18257899 CGGGCAGCTGACGCCCCTCCTGG + Intergenic
1108342881 13:49515115-49515137 TGGGATGCAGACTTCCCTACTGG + Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113933007 13:113978267-113978289 CGGGGTGCAGACGTCCCTCCAGG - Exonic
1114696544 14:24631998-24632020 CTGGGGGCAGACGGCCCCCCTGG - Exonic
1122274492 14:100584780-100584802 AGGGCTGCAGACCTCCGTCCAGG + Intronic
1122788685 14:104175445-104175467 CGGGGTGCCCACGGCCTTCCTGG - Exonic
1126150739 15:45522144-45522166 CGGGGCGCACCCGACCCTCCAGG - Exonic
1133220864 16:4318650-4318672 TGGGGTCCAGGCCTCCCTCCAGG - Intronic
1136368248 16:29819651-29819673 CAGGCTGAAGAGGTCCCTCCCGG - Exonic
1137864062 16:51875688-51875710 CTGGGTGCAGAGGTCCCACTAGG - Intergenic
1138526975 16:57614498-57614520 CTGGGACCAGATGTCCCTCCTGG - Intronic
1138538084 16:57670389-57670411 CCAGGTGCAGGCCTCCCTCCCGG - Intronic
1138577960 16:57920580-57920602 GGGGGTGCACAGGTCCCTCCCGG - Intronic
1142291081 16:89193835-89193857 GGGGGTGCAGGCGGCCCTGCGGG - Exonic
1142353245 16:89589364-89589386 CGGGACACAGACGTCCCCCCAGG - Intronic
1142737087 17:1907918-1907940 CGGGGTGCAGCCTCCTCTCCTGG + Intergenic
1145878970 17:28340284-28340306 AGGGGTGCAGAAGGCCCTACAGG - Intronic
1145960274 17:28883114-28883136 TGGAGCGCAGATGTCCCTCCAGG + Exonic
1148809100 17:50279070-50279092 CTGGGTGCAGAGTGCCCTCCAGG - Intronic
1151594168 17:75066805-75066827 CAGGGTGCAGTCCTCACTCCTGG + Intergenic
1153937028 18:9936670-9936692 TGGAGTGCAGTCGCCCCTCCTGG - Intronic
1155071241 18:22318254-22318276 CAGGGTGGAGAGGTGCCTCCTGG + Intergenic
1158549500 18:58423175-58423197 CGGGAGGCAGATGTCCATCCAGG + Intergenic
1160679511 19:406384-406406 CGGGGAGGAGACGGCTCTCCTGG - Exonic
1163669036 19:18617029-18617051 CGCGCTGCAGACGGCCCCCCTGG - Exonic
1163808769 19:19417251-19417273 AGGGGTGCAGACGTCCTTGTGGG + Intronic
1165150906 19:33759581-33759603 CGGGGGGCAGACGTGCCTGTGGG - Intronic
1165436191 19:35796841-35796863 GGTGGTGCAGACGGCCCACCTGG + Intergenic
932426740 2:71642581-71642603 CTGGCTGCAGAAGACCCTCCGGG + Intronic
935652998 2:105398592-105398614 CGGGCTGCAGTCCTCCCTCTGGG + Intronic
943645886 2:190408047-190408069 CTGGGTTCAGGTGTCCCTCCGGG + Intergenic
948000469 2:234562986-234563008 CGGGGGGCTGACCTCCCCCCCGG - Intergenic
948205193 2:236159760-236159782 GGGGGGGCGGACGTCACTCCGGG - Intergenic
949021252 2:241742594-241742616 CGGGGCCCAGGAGTCCCTCCTGG + Intronic
1170655964 20:18288226-18288248 CCGGGTGCGGAAGTCGCTCCAGG + Intergenic
1171404370 20:24900078-24900100 AGGGGTGTAGAGGGCCCTCCAGG - Intergenic
1173548373 20:43915786-43915808 CGGTGAGCCGGCGTCCCTCCAGG + Intronic
1175772923 20:61635102-61635124 TGGGGTGCAGACCTCTCTTCGGG + Intronic
1175809058 20:61847754-61847776 AGGGGAGCAGACGTCCCACGTGG + Intronic
1175979882 20:62733253-62733275 GGAGGTGCAGAGGTGCCTCCAGG - Intronic
1176302340 21:5104582-5104604 CAGGGTGCAGAAGACCCGCCAGG + Intergenic
1177834325 21:26171981-26172003 CGGGGTACAGACTTCCTTCCTGG + Intergenic
1179854687 21:44157341-44157363 CAGGGTGCAGAAGACCCGCCAGG - Intergenic
1180214902 21:46317749-46317771 GGGGGTGCAGAGGTGCCCCCAGG + Intronic
1180765105 22:18341559-18341581 CGGGCAGCTGACGCCCCTCCTGG - Intergenic
1180813924 22:18778125-18778147 CGGGCAGCTGACGCCCCTCCTGG + Intergenic
1181200109 22:21212460-21212482 CGGGCAGCTGACGCCCCTCCTGG + Intronic
1182736376 22:32534338-32534360 AGGGCTCCAGAAGTCCCTCCAGG + Intronic
1203226727 22_KI270731v1_random:82464-82486 CGGGCAGCTGACGCCCCTCCTGG - Intergenic
1203264023 22_KI270734v1_random:3812-3834 CGGGCAGCTGACGCCCCTCCTGG + Intergenic
950055778 3:10023350-10023372 AGGGGTGCACATGTTCCTCCTGG - Intergenic
952331548 3:32368142-32368164 CAGGGGGCAGAGGGCCCTCCTGG + Intronic
953929461 3:46998756-46998778 CACCGTGCAGACCTCCCTCCTGG + Exonic
967694538 3:192515303-192515325 CGGGGTCCAGCCCTCCCTGCGGG - Intronic
968492617 4:898341-898363 CGGGGTGCAGGGGCCGCTCCAGG + Intronic
968514751 4:1011440-1011462 CGCGGTGCGGACGTCCCCGCGGG - Intronic
969471127 4:7389912-7389934 AGGGGTGCGGGCCTCCCTCCTGG + Intronic
972740392 4:41881852-41881874 CGGGGAGCAGCCGTTACTCCTGG - Intergenic
985532808 5:443654-443676 CTTGGGGCAGATGTCCCTCCAGG + Intronic
985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG + Intronic
985765006 5:1772864-1772886 CGGGGAGCAGACGTCTCCTCTGG - Intergenic
986051576 5:4094946-4094968 TGTGGTGCAGCCCTCCCTCCTGG - Intergenic
992680928 5:79152352-79152374 TGGGGTGCAAATGTCCCTCCCGG - Intronic
1001395703 5:171418825-171418847 CGGCGTGCAGCCGTCCGTGCTGG + Intergenic
1002182074 5:177435898-177435920 CGGGGTGAATACGGCCCTGCAGG - Intronic
1006253077 6:32807248-32807270 CGGGGTGCCCACCTCCCTGCAGG + Intergenic
1012398296 6:98824592-98824614 CTGGGTGCAGGCGCCTCTCCGGG + Intergenic
1019294029 7:264560-264582 TGGGGTGGAGCCGTCCCTTCCGG + Intergenic
1020586898 7:10079741-10079763 CAGGGTGCTGGCGTCCCTGCTGG + Intergenic
1021189418 7:17602802-17602824 TGGAGTGGAGACGGCCCTCCTGG - Intergenic
1021577835 7:22120598-22120620 CGGAGAGCAGACTTCCCTCACGG - Exonic
1023366132 7:39465150-39465172 AGGGGTGCAGTCCTTCCTCCAGG - Intronic
1026805779 7:73429137-73429159 TGGGGAGAAGCCGTCCCTCCTGG - Intergenic
1029551565 7:101239540-101239562 GGGGGCGGAGACGTCACTCCTGG - Intronic
1034257798 7:149733975-149733997 AGGAGTGCAGAGGGCCCTCCAGG + Exonic
1034629291 7:152518119-152518141 AGGGGTGCTGAGGTCCCTTCAGG - Intergenic
1034946190 7:155263348-155263370 CGGGGTGCAGCCTTCACTCAAGG + Intergenic
1034978178 7:155459761-155459783 AGGGAGGCAGCCGTCCCTCCCGG + Intronic
1036847235 8:12178519-12178541 CAGGGTGCACACATCCCTGCAGG + Intergenic
1036868602 8:12420840-12420862 CAGGGTGCACACATCCCTGCAGG + Intergenic
1037980029 8:23246740-23246762 CGGGGGGCAGAAGGCCCGCCGGG - Exonic
1046380923 8:113449577-113449599 CGGTGTGCTGACATCCCTGCTGG + Intergenic
1049805319 8:144536207-144536229 CTGTGGGCAGCCGTCCCTCCTGG - Intronic
1056012511 9:82346691-82346713 CAGGGTACAGGCCTCCCTCCTGG - Intergenic
1056865558 9:90225149-90225171 CGGGGGGAAGACAACCCTCCGGG + Intergenic
1057179137 9:93020439-93020461 CGGGGTGCAGAGAGACCTCCAGG + Intronic
1061108977 9:128553117-128553139 CGAGCTGCAGAAGTCGCTCCCGG - Intronic
1061773255 9:132944265-132944287 CAGGGTGCAGCCGTCCCCTCGGG + Intronic
1185570115 X:1128231-1128253 GGGGGTGCAGATGTCACTGCAGG + Intergenic
1185570174 X:1128519-1128541 GGGGGTGCAGATGTCACTGCAGG + Intergenic
1197883411 X:131192871-131192893 CTGAGTGCAGACTTCCTTCCAGG - Intergenic
1197952024 X:131908130-131908152 CGGGGTGGGGAGGTCCTTCCTGG - Intergenic
1198758485 X:140006085-140006107 AGGGGTTCAGATGTTCCTCCTGG - Intergenic