ID: 1113937248

View in Genome Browser
Species Human (GRCh38)
Location 13:114001001-114001023
Sequence CTCAGAACGCAGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113937248_1113937255 -5 Left 1113937248 13:114001001-114001023 CCCCCCACTTTCTGCGTTCTGAG 0: 1
1: 0
2: 0
3: 21
4: 241
Right 1113937255 13:114001019-114001041 CTGAGACCTGAGGCAGGCAGTGG 0: 1
1: 0
2: 14
3: 83
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113937248 Original CRISPR CTCAGAACGCAGAAAGTGGG GGG (reversed) Intronic
900986170 1:6073887-6073909 CTCACAAAACAGAAAGAGGGAGG - Intronic
903318513 1:22527342-22527364 CTCACAAGGCAGGGAGTGGGCGG - Exonic
904490291 1:30854488-30854510 CTCAGGAGGTAGAAAGAGGGAGG - Intergenic
908896688 1:68909188-68909210 CTCAGGAGGCTGAAGGTGGGTGG + Intergenic
909783085 1:79573856-79573878 CTCAAAACGTAGAAAGTGTTGGG - Intergenic
913030110 1:114892918-114892940 CTTAGAACTCAGAGGGTGGGTGG + Intronic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913595449 1:120371669-120371691 CTCAGAAGACAGAGAGTTGGGGG + Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914091825 1:144507306-144507328 CTCAGAAGACAGAGAGTTGGGGG - Intergenic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914306714 1:146426558-146426580 CTCAGAAGACAGAGAGTTGGGGG + Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914595335 1:149146244-149146266 CTCAGAAGACAGAGAGTTGGGGG - Intergenic
916193488 1:162201053-162201075 ATCAGAGGGCAGAGAGTGGGAGG - Intronic
916609337 1:166375173-166375195 GTCAGAAAGGAAAAAGTGGGAGG - Intergenic
916816978 1:168363676-168363698 CTCACATGGCAGAAGGTGGGAGG - Intergenic
916963775 1:169914653-169914675 CTCAGAAGACAAAAAGCGGGTGG - Intergenic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
918383640 1:183983696-183983718 CTGAGAACCCAGAATGTGTGAGG + Intronic
919249295 1:195031293-195031315 CTCAGAAGGAGGGAAGTGGGAGG - Intergenic
920140932 1:203812270-203812292 ATCAGAAGGTAGAAGGTGGGAGG - Intronic
921359983 1:214322500-214322522 CACAAAAAGCAGAAAATGGGAGG - Intronic
922927952 1:229366146-229366168 CTCAGAACGGGGAGAGTGGGAGG - Intergenic
922963382 1:229667063-229667085 CTCAAAACCCAGAGAGTGGTGGG + Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1068324907 10:55472134-55472156 CTCAGAAAGCACAAAGAGAGAGG - Intronic
1068524834 10:58116545-58116567 CTCAAAAAGCAGAAAATGAGAGG + Intergenic
1069110012 10:64435646-64435668 CTCAGAAGGGAGAAACTGGGAGG + Intergenic
1069289594 10:66761289-66761311 ATCAGAAAGGAAAAAGTGGGTGG - Intronic
1071745630 10:88415974-88415996 ATCAGAACACTGAAAGTGGAAGG - Intronic
1073128036 10:101164450-101164472 GTCAGACCACAGAAAGTGAGGGG + Intergenic
1074029621 10:109673247-109673269 CTCAGAATGGGGAGAGTGGGAGG + Intergenic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077276205 11:1710266-1710288 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1077707362 11:4499840-4499862 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1078527216 11:12110418-12110440 CCCAGAACGCAGGGAGTGGCCGG - Intronic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1082891852 11:58147546-58147568 CTCACAAAGTAGAAACTGGGAGG - Intronic
1083673560 11:64313483-64313505 CTCAGAAACCACAAAGTGGCTGG + Intronic
1084482939 11:69432536-69432558 CTGAGAAGCCAGAATGTGGGTGG + Intergenic
1085501348 11:77027905-77027927 ATGAGAAAGCAGAAAATGGGGGG + Intergenic
1086276336 11:85133992-85134014 CTCAGAAAGGAGAGAGGGGGTGG + Intronic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1088715729 11:112547536-112547558 CTCAGAAAGCAGTAAGTGAGTGG + Intergenic
1089508184 11:118979030-118979052 CTCAGGACGTAGGAAGAGGGAGG + Exonic
1090925871 11:131250069-131250091 TTAAGAACACAGAAAGTGGCAGG - Intergenic
1091654313 12:2334177-2334199 TACACAAGGCAGAAAGTGGGTGG + Intronic
1098375152 12:69807183-69807205 CTCACATCCCAGACAGTGGGCGG + Intronic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1100034773 12:90236899-90236921 GTCAACAGGCAGAAAGTGGGAGG - Intergenic
1101672603 12:106890173-106890195 CACAGAACACAGAAAGTGACTGG - Intergenic
1101997493 12:109535425-109535447 CTGAGGACGCAGAAAATGGGAGG - Exonic
1103155577 12:118681977-118681999 CTCAAAACCTAGAAACTGGGAGG + Intergenic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1104888250 12:132124748-132124770 CTCAGAACGCAGGGAGAAGGCGG + Intronic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1106413179 13:29525067-29525089 CCCAGAACACAGCATGTGGGGGG - Intronic
1106652506 13:31706771-31706793 CACAGATAGCAGAAAGTTGGAGG + Intergenic
1108841869 13:54627865-54627887 CTCAGAACGAAGGAAGTCAGTGG + Intergenic
1109749763 13:66673609-66673631 CTCAGAAGGCAGAAACTCTGTGG + Intronic
1112124958 13:96454997-96455019 TTCAGAAAGCAGAAAAGGGGAGG - Intronic
1113937248 13:114001001-114001023 CTCAGAACGCAGAAAGTGGGGGG - Intronic
1114479695 14:23025065-23025087 GTCAGAAGGCAGAAAGTGGTTGG - Intronic
1115213641 14:30992931-30992953 CTCAGAAGGCTGAAGTTGGGAGG - Intronic
1115943109 14:38630108-38630130 CTCAGAAGACAGAAAGAGGTGGG - Intergenic
1118007117 14:61573480-61573502 CTCTGAAAGCAGAACTTGGGTGG - Intronic
1119085128 14:71732405-71732427 CTCAGTAGGCAGAAGCTGGGTGG - Intronic
1119235862 14:73018636-73018658 CCCAGAACACAGAAAGTGCCTGG + Intronic
1119396234 14:74328143-74328165 CTCATAACCCAGGAAGTTGGAGG - Intronic
1120142815 14:80947338-80947360 CACAGAAAGCAGAAAGGGAGGGG + Intronic
1120875589 14:89372026-89372048 CTCAGAAAGAAGAAACTGTGGGG - Intronic
1120941489 14:89954588-89954610 CTCGGAACACAGGAAGTGGGTGG - Exonic
1121935307 14:98013009-98013031 CTGAGAACACCAAAAGTGGGTGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122217918 14:100215951-100215973 CTCAGAACACAGAAAAAGAGGGG + Intergenic
1122459277 14:101882015-101882037 CTCAAAACGCAGAAGCTGTGTGG - Intronic
1122982812 14:105199236-105199258 CTCAGGCCACAGGAAGTGGGAGG + Intergenic
1123892733 15:24797657-24797679 CACAAAAGGCAGAAAATGGGTGG - Intergenic
1125001222 15:34772127-34772149 CTCAGAAAGCAGAGAGATGGAGG - Intergenic
1125797745 15:42416026-42416048 CTCAAAACTCAGAACGTGGCCGG - Exonic
1126667866 15:51091282-51091304 CTCTGCACGCACAAAGTGGGGGG + Intronic
1127726929 15:61759515-61759537 CTAAGTAGGCAGACAGTGGGAGG - Intergenic
1128369549 15:67030316-67030338 GGCAGAGCACAGAAAGTGGGAGG + Intergenic
1130041884 15:80411921-80411943 CACAGAAGGCAGTAAATGGGAGG - Intronic
1130578491 15:85114670-85114692 TTCAGAAAGCAGTAATTGGGAGG - Intronic
1132659158 16:1053886-1053908 CCCCGCACGCAGACAGTGGGGGG + Intergenic
1135200130 16:20430037-20430059 CTCAGAAGGAAGAAGGTGAGAGG + Intronic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135905686 16:26509770-26509792 CTCAGAGCTCTGAAAGTGGAAGG + Intergenic
1136515465 16:30765485-30765507 CTCAGCATGCAGAAGGTGAGCGG + Exonic
1136642288 16:31577106-31577128 CTCAGAAGGCAGAAAGATGTGGG + Intergenic
1138271261 16:55697688-55697710 CTCAGAACTCAGAAACTACGTGG - Intronic
1139134101 16:64180381-64180403 CTCAGAAGATAGAAGGTGGGAGG + Intergenic
1139164293 16:64547812-64547834 ATCAGAGGGCAGAGAGTGGGAGG - Intergenic
1139714016 16:68798326-68798348 CTCTGAGCCCAGCAAGTGGGAGG - Intronic
1140635502 16:76908269-76908291 CTCAGAAGGCTGAAAATGGGAGG + Intergenic
1141035752 16:80623979-80624001 CTCAGAACGTAGCATGTGGCAGG - Intronic
1141255431 16:82397534-82397556 CTCAGCACTCAGAATCTGGGTGG - Intergenic
1141336953 16:83165041-83165063 CTCTGATCACAGAAAGTGTGTGG + Intronic
1141343303 16:83223299-83223321 CTCATATGGCAGAAAGTGGAAGG + Intronic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1144091141 17:11857570-11857592 TTCAGAATACAGAAAGTGGGTGG + Intronic
1146554614 17:33812934-33812956 TCCAGAACTCAGAAGGTGGGAGG + Intronic
1147327475 17:39676409-39676431 CTCAGAACACCGAAAGCAGGGGG + Intronic
1148598723 17:48878004-48878026 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1148765063 17:50033848-50033870 CTAAGAAGGAAGAAATTGGGAGG + Intergenic
1151356797 17:73563468-73563490 CTCAGAAGGCTGAATGTGGGAGG + Intronic
1151698095 17:75728276-75728298 CTCAGAAGGGAGGAAGAGGGAGG - Intronic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1152979226 18:258581-258603 CTCAGAACATATAAAGTAGGTGG + Intronic
1153468985 18:5421810-5421832 CTCAGAAGGCAGACAGTGGCGGG + Intronic
1155727357 18:29104461-29104483 CTCAGAATTCAGACAGTGGCTGG + Intergenic
1157508809 18:48252794-48252816 GCCAGAATGCTGAAAGTGGGAGG + Intronic
1158674692 18:59507513-59507535 CTCAGAAGCCAGACAGAGGGTGG - Intronic
1158814432 18:61077546-61077568 CTAAGAAAGCAGAAAATGTGTGG + Intergenic
1159148009 18:64480222-64480244 CCTAGAACACAGAAAGTGGATGG + Intergenic
1162522841 19:11192253-11192275 GTCAGTATCCAGAAAGTGGGAGG - Intronic
1163520617 19:17789407-17789429 CTCAGAAGGAAGGAAGTAGGAGG + Intergenic
1167375691 19:49110002-49110024 ATCAGAATGCAGTAACTGGGAGG + Intergenic
925079139 2:1047751-1047773 CTCAGAACACTGAAAGGGAGAGG - Intronic
926536281 2:14116922-14116944 AACAAAACTCAGAAAGTGGGTGG + Intergenic
928431874 2:31226875-31226897 CTCAGTCCACAAAAAGTGGGAGG - Intronic
935793736 2:106618892-106618914 GTCAGGAAGCAGAAAGAGGGAGG + Intergenic
935845238 2:107159016-107159038 CTCAAAACTCAAAAAGAGGGGGG + Intergenic
935931335 2:108129635-108129657 CATAGAACGCAGAAAGGTGGGGG - Intergenic
936073476 2:109386623-109386645 CTAAGAGCTCAGAAAGTGGTAGG - Intronic
937514721 2:122640456-122640478 CAAAGAAAGCAGAAAATGGGAGG - Intergenic
937806939 2:126157367-126157389 CTTAGAACAAAGAAAGTTGGAGG - Intergenic
938112617 2:128578972-128578994 CTCAGAAGGCAGAGGTTGGGCGG - Intergenic
942256151 2:174100510-174100532 CTCAGAAGGCTGAGCGTGGGAGG - Intronic
943432653 2:187824162-187824184 TTCAGAAGGCAGAGGGTGGGAGG - Intergenic
943551624 2:189347357-189347379 AACAGAAAGCAGAAAGAGGGAGG + Intergenic
1168851184 20:978122-978144 CTCAGCACTCAGGAGGTGGGGGG + Intronic
1169750816 20:8991713-8991735 CTGAGAAAGCATAAACTGGGTGG + Intergenic
1171952261 20:31430968-31430990 CTTAGTAAGCAGAAAATGGGAGG - Intergenic
1173302120 20:41813147-41813169 CTCAGAATGCACAAAATGGGGGG + Intergenic
1174234898 20:49081390-49081412 CTCGGGAGGCTGAAAGTGGGAGG - Intronic
1175288655 20:57857124-57857146 CTCAGAACAAAGAAAGATGGAGG - Intergenic
1178018413 21:28379024-28379046 ATCAGAAAGCAGAAAGTTGGGGG + Intergenic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1181045108 22:20210677-20210699 CTCACAAAGCAGCAAGGGGGAGG - Intergenic
1181937680 22:26450330-26450352 TTAAGAACGCAGTAACTGGGCGG + Intronic
1182387987 22:29963026-29963048 CTCGGGAGGCTGAAAGTGGGAGG - Intronic
1183145359 22:35985797-35985819 ATCAGATCACAGAAGGTGGGAGG + Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
951215307 3:20019150-20019172 CTCAGGAGGTTGAAAGTGGGAGG - Intergenic
951938904 3:28055433-28055455 CACAGAGGGCAGAAAGTGGAAGG - Intergenic
953263587 3:41364037-41364059 CTCAGGAGGCTGAAAGTGGGAGG - Intronic
955995287 3:64674611-64674633 CTAAGAATGCAGAAAGTGTGTGG + Intronic
958698423 3:97556200-97556222 ATCAGAAGGCAGAGAGTGTGGGG - Intronic
959897104 3:111617424-111617446 CTCAGAAGGGAGAAAGTGCATGG - Intronic
959977696 3:112480566-112480588 GGCAGAAAGCAGAAAGTGGAAGG + Intronic
962797806 3:138864105-138864127 CTCAGGAGGCAGAGACTGGGAGG - Intergenic
963904726 3:150763645-150763667 CTCCGAACACAGAACGCGGGTGG - Intergenic
966190472 3:177267845-177267867 CTCAGAATGCAGAGGTTGGGAGG - Intergenic
968132013 3:196197544-196197566 CTCAGGGCTCAGGAAGTGGGAGG + Exonic
968754307 4:2407415-2407437 CTCAGAACGCAGCATCTGAGGGG - Intronic
969849881 4:9947872-9947894 GTCAGGAGGCAGAAAGAGGGAGG - Intronic
971620176 4:28845630-28845652 ATCAGAGGGTAGAAAGTGGGAGG - Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
974377080 4:61092675-61092697 CTCAGAAGCCAGAAGGAGGGTGG + Intergenic
978772489 4:112471414-112471436 CTCAGAAGGCAGAAGGCAGGGGG + Intergenic
981701163 4:147608830-147608852 CTCAGAACTCAGCCAGTGGACGG - Intergenic
981907130 4:149934187-149934209 CTCAGAAGGTGGGAAGTGGGGGG + Intergenic
982907940 4:161100608-161100630 CTCAGAACCCACAAAGTAGGTGG - Intergenic
983074159 4:163304564-163304586 CTCTGAACACAGGAAGTGGTGGG + Intergenic
985493977 5:194166-194188 CTCAGAAAGCAGACGGCGGGGGG - Intronic
985493985 5:194216-194238 CTCAGAAAGCAGACGGCGGGGGG - Intronic
985612194 5:896203-896225 CTCAGAAGGCTGGAGGTGGGAGG + Intronic
986308969 5:6537076-6537098 CTCAGTAAGCCGAAATTGGGGGG - Intergenic
986727179 5:10607479-10607501 GTCAGAACTCAGAAAGGGTGGGG + Intronic
988780017 5:34512100-34512122 CTCAGAAATCAGAGAGAGGGAGG + Intergenic
990311424 5:54542512-54542534 CTCAGCACACAGAAAGTGCCTGG - Intronic
992459974 5:76951772-76951794 CTCAGACCACAGACAGTGAGAGG - Intergenic
992614566 5:78535896-78535918 CTCAGAACTCTGAGACTGGGGGG - Intronic
995223525 5:109677906-109677928 CTCAGGAGGCTGATAGTGGGAGG - Intergenic
995647195 5:114326321-114326343 GGCAGAAGGCTGAAAGTGGGAGG + Intergenic
996262238 5:121486359-121486381 CTCAGAGAGGAGAGAGTGGGAGG + Intergenic
997959667 5:138310028-138310050 CTGAGAAGGTAGAAAGTGGCTGG - Intronic
998409993 5:141902555-141902577 GTCAGAGCACATAAAGTGGGAGG - Intergenic
1000920217 5:167129164-167129186 CCCAGAACCCAGGAAGTGGCTGG + Intergenic
1001068210 5:168557736-168557758 CTAACAACGCAGAAATTGGTAGG - Intronic
1001293773 5:170484782-170484804 AGCAGAACGCAGAGAGAGGGTGG - Intronic
1001713640 5:173797344-173797366 CTGAGGCTGCAGAAAGTGGGCGG - Intergenic
1001794761 5:174492772-174492794 CCCAGAACACAGACAGTGTGTGG + Intergenic
1002374700 5:178780289-178780311 ATCAGAAAGCAGCAAGTGGTAGG - Intergenic
1003154739 6:3581809-3581831 CTCACATCACAAAAAGTGGGAGG - Intergenic
1003435642 6:6085488-6085510 CTCAGAAGGGAGAGAGTGAGAGG + Intergenic
1004906053 6:20238348-20238370 CTCAGGACTCAGGAAGTGGATGG + Intergenic
1005290382 6:24373834-24373856 TTTAGAAGGAAGAAAGTGGGAGG + Intergenic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1007335166 6:41150487-41150509 CTCTGGAAGCAGTAAGTGGGTGG - Intronic
1007765578 6:44157930-44157952 CCCAGAAAGGAGAAAGGGGGAGG + Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1009331173 6:62422583-62422605 CTCAGGTGGCAGAAAGTGGAAGG - Intergenic
1011046296 6:83087046-83087068 TTCAGAACACAGCAAGAGGGAGG + Intronic
1012436096 6:99216491-99216513 CTGATAAAGCATAAAGTGGGAGG + Intergenic
1013124581 6:107170614-107170636 CTCAGAAAAAAAAAAGTGGGGGG - Intronic
1014024090 6:116624610-116624632 CTCAGAAAGTAGAAAGAGGCAGG + Intronic
1014728486 6:125002676-125002698 ATCAGAAAGCAGAAAGGAGGAGG - Intronic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1017382737 6:153848826-153848848 CTCTGAAGGGAGAAACTGGGTGG + Intergenic
1023461983 7:40408408-40408430 CTAAGTAAGCAGAAAGCGGGAGG - Intronic
1024910719 7:54444247-54444269 CTCACATCCCAGACAGTGGGCGG - Intergenic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026911095 7:74092506-74092528 GTCAGAACACAGAAAGGGGCAGG - Intronic
1027515099 7:79132294-79132316 CTCAGAAGGGGGAGAGTGGGAGG - Intronic
1027849240 7:83428139-83428161 CTCAGAACCCAGAATGTCTGTGG + Intronic
1032267101 7:130377387-130377409 GCCAGAACGCAAACAGTGGGAGG - Intergenic
1032926291 7:136608942-136608964 TTCAGAACGTAGAGGGTGGGAGG + Intergenic
1033723798 7:144090678-144090700 ATCAGAAGGCAGAAGGTGAGAGG - Intergenic
1035068445 7:156124308-156124330 CCCAGAACGTGGGAAGTGGGAGG + Intergenic
1035874181 8:3169808-3169830 ACCAGAAAGAAGAAAGTGGGGGG - Intronic
1037024019 8:14009815-14009837 CTCACAGGGCAGAAAGTGGAAGG - Intergenic
1037855430 8:22367723-22367745 CGCAGAACGCAGACAGTAGGTGG + Intronic
1038466094 8:27765104-27765126 CTCAGAACCAACAAACTGGGTGG + Intronic
1038533600 8:28338225-28338247 ATCAGAACCAAGAACGTGGGAGG + Intronic
1040049390 8:42997187-42997209 CTCTGCACTCAGGAAGTGGGTGG - Intronic
1040674743 8:49735055-49735077 CTCTCAACACAGTAAGTGGGAGG + Intergenic
1040741249 8:50579050-50579072 CTCAGAAGACAGAAAGTTGTGGG + Intronic
1041254619 8:55969162-55969184 CACAGGAGGCTGAAAGTGGGAGG + Intronic
1041291954 8:56316497-56316519 CTCTGTATTCAGAAAGTGGGAGG + Intronic
1043198462 8:77330687-77330709 CTTAGATCGCAGAAAGGGTGTGG + Intergenic
1044301125 8:90584382-90584404 CTCAGAAGTCAGACATTGGGGGG - Intergenic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1047115876 8:121841504-121841526 CTCAGAAGACAGAAAGAGGGGGG + Intergenic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1049376746 8:142292958-142292980 CTCAGCACATAGAAAGTGGGGGG + Intronic
1051718968 9:20015678-20015700 ATGAGAAGACAGAAAGTGGGTGG - Intergenic
1051758680 9:20435631-20435653 CTATGTAGGCAGAAAGTGGGAGG + Intronic
1052695264 9:31869684-31869706 CTTAGAACTCAGAGAGTGTGTGG + Intergenic
1054888591 9:70227303-70227325 CTCAGTACCCAGAAAGTGTCTGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1056089869 9:83195025-83195047 CTCTGAGCGCAGAAAGTGAGGGG - Intergenic
1057336516 9:94159897-94159919 CTGAGCACACAGAAAATGGGAGG + Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057474249 9:95385190-95385212 CTCACACGGCAGAAAGTGGACGG + Intergenic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1062344431 9:136108372-136108394 CTCAGAAGCCAGGCAGTGGGTGG - Intergenic
1062630754 9:137462082-137462104 TTGAGAACACAGGAAGTGGGGGG - Intronic
1062641803 9:137522615-137522637 CTCAGAACTGAGAAAGTAAGTGG + Intronic
1186584673 X:10859908-10859930 CTCAGGTGGCAGAGAGTGGGGGG + Intergenic
1186627894 X:11314782-11314804 CTCAGAAGGTAGAGGGTGGGAGG + Intronic
1186803856 X:13119864-13119886 TTCAGATTGCAGAAAGTGGCAGG - Intergenic
1186976979 X:14917914-14917936 CTGAGAAGGCTGAAAGTGCGGGG + Intronic
1187483662 X:19681733-19681755 CCCAGAACGAAGAAAGTGAAGGG + Intronic
1187771288 X:22699723-22699745 CTCAGAAGGAAGAATGTGGTGGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188993893 X:36858709-36858731 CTCAGAACTGAGAAAGTCAGGGG - Intergenic
1189573931 X:42329733-42329755 CTCAGAGCGTGGAAGGTGGGAGG + Intergenic
1193964368 X:87966578-87966600 CTCATAAGGGAGAAGGTGGGAGG + Intergenic
1194254059 X:91614397-91614419 CTCAGAAGGCAGAAAGATGTGGG - Intergenic
1194597339 X:95874665-95874687 CTCAGAAGGGAGAGGGTGGGAGG + Intergenic
1197644289 X:129001300-129001322 CTAAAAACCCATAAAGTGGGCGG + Intergenic
1198676446 X:139136347-139136369 CTCAGAACGGGGAGGGTGGGGGG - Intronic
1200572847 Y:4853974-4853996 CTCAGAAGGCAGAAAGATGTGGG - Intergenic
1201579112 Y:15492569-15492591 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1202340863 Y:23865364-23865386 CTCAGAAGTCAGAAGGTGGTGGG - Intergenic
1202529903 Y:25804722-25804744 CTCAGAAGTCAGAAGGTGGTGGG + Intergenic