ID: 1113938735

View in Genome Browser
Species Human (GRCh38)
Location 13:114007822-114007844
Sequence CCGGGCTCAGGCAACACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113938721_1113938735 16 Left 1113938721 13:114007783-114007805 CCCAGCCCCGGCACTGCCACAGA 0: 1
1: 0
2: 7
3: 38
4: 338
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938720_1113938735 17 Left 1113938720 13:114007782-114007804 CCCCAGCCCCGGCACTGCCACAG 0: 1
1: 0
2: 5
3: 50
4: 524
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938724_1113938735 10 Left 1113938724 13:114007789-114007811 CCCGGCACTGCCACAGAGATCTC 0: 1
1: 0
2: 1
3: 16
4: 292
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938716_1113938735 29 Left 1113938716 13:114007770-114007792 CCCACTGTGCCACCCCAGCCCCG 0: 1
1: 0
2: 2
3: 40
4: 347
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938722_1113938735 15 Left 1113938722 13:114007784-114007806 CCAGCCCCGGCACTGCCACAGAG 0: 1
1: 0
2: 3
3: 37
4: 315
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938717_1113938735 28 Left 1113938717 13:114007771-114007793 CCACTGTGCCACCCCAGCCCCGG 0: 1
1: 1
2: 3
3: 52
4: 640
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938727_1113938735 0 Left 1113938727 13:114007799-114007821 CCACAGAGATCTCAGGTGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 279
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938715_1113938735 30 Left 1113938715 13:114007769-114007791 CCCCACTGTGCCACCCCAGCCCC 0: 1
1: 0
2: 6
3: 85
4: 779
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938719_1113938735 20 Left 1113938719 13:114007779-114007801 CCACCCCAGCCCCGGCACTGCCA 0: 1
1: 0
2: 6
3: 103
4: 823
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938725_1113938735 9 Left 1113938725 13:114007790-114007812 CCGGCACTGCCACAGAGATCTCA 0: 1
1: 0
2: 4
3: 23
4: 227
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152
1113938723_1113938735 11 Left 1113938723 13:114007788-114007810 CCCCGGCACTGCCACAGAGATCT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113938735 Original CRISPR CCGGGCTCAGGCAACACCTG GGG Intronic
900611455 1:3546333-3546355 GATGGCTCAGGCAAGACCTGGGG - Intronic
900651140 1:3730626-3730648 AGGGCCTCAGGAAACACCTGGGG - Intronic
900803002 1:4748995-4749017 CCTGGCTCAGTCCACTCCTGCGG - Intronic
900940618 1:5796281-5796303 CAGGGCTCAGTCACCACCAGGGG + Intergenic
902123819 1:14191561-14191583 CCGGGCTCAAGGAACACGTCTGG + Intergenic
905337864 1:37257764-37257786 CAGGGCACAGACACCACCTGGGG + Intergenic
907247478 1:53117235-53117257 CCGAGCTCAGGTAATATCTGAGG + Intronic
915695799 1:157740065-157740087 CCTGGCTCAGCCATCAGCTGAGG + Intergenic
916315023 1:163439332-163439354 CCAGGCAAGGGCAACACCTGGGG - Intergenic
916631490 1:166618697-166618719 CTGGGTTCAGGCAACTCCTTCGG + Intergenic
917274118 1:173312656-173312678 CCAGGCTCAGGCATAAACTGTGG + Intergenic
918385680 1:184005153-184005175 CGGGGCTCAGTCAACATCTGTGG + Intronic
918783446 1:188732368-188732390 TCGGGCTCAGGCAGGTCCTGAGG - Intergenic
919273110 1:195376663-195376685 CCAGGCAGAGGCAGCACCTGTGG + Intergenic
920375540 1:205505926-205505948 CAGGGCCCAGGCTACAGCTGGGG - Intronic
921568977 1:216755923-216755945 CCAGGGTCAGGCAACATCTCTGG - Intronic
923391197 1:233515529-233515551 CCGGGCTCAGGGGAGGCCTGAGG - Intergenic
923789081 1:237095801-237095823 CATGGCTCAGGCAACAACTCAGG + Intronic
924560399 1:245153826-245153848 CCGGGCGCAGGGATCACGTGGGG - Intergenic
1063234337 10:4096967-4096989 TTGGGCTCAGGCAAGAACTGAGG + Intergenic
1069901615 10:71709699-71709721 CAGGGCTCAGGTGACACCTCAGG + Intronic
1072510964 10:96124480-96124502 ACAGGCTCAGAAAACACCTGAGG - Intergenic
1077146964 11:1050699-1050721 GCGGGGACAGGCAACCCCTGCGG + Intergenic
1077344361 11:2039508-2039530 CAGGGCACAGGCACCTCCTGTGG + Intergenic
1079818546 11:25094557-25094579 CCGGGCCCTGGGGACACCTGAGG - Intergenic
1082806009 11:57451048-57451070 TTTGGCTCAGGCAAGACCTGGGG + Intergenic
1083299897 11:61734843-61734865 CAGGACACAGGCAACACCTAGGG - Exonic
1083436718 11:62648067-62648089 ACAGGCTGAGGCCACACCTGGGG + Exonic
1084181954 11:67451310-67451332 CCGGGCGCAGGCCCCACGTGAGG - Exonic
1084268618 11:68017487-68017509 CCTGGCTGAGGCAGCGCCTGAGG - Intronic
1084398049 11:68927510-68927532 CAGGGCTCAGGAAAGACCTCGGG - Intronic
1084492492 11:69486429-69486451 CCAAGCTCAGGCAACACCTGGGG - Intergenic
1084541328 11:69788812-69788834 CAGGGCTCAGGGAACAGCAGGGG + Intergenic
1085073193 11:73567137-73567159 CTGAGCTAAGGCAACAGCTGTGG + Intronic
1087659061 11:100964463-100964485 CCTGGCTCAGGCTAAACATGAGG - Intronic
1087873477 11:103327061-103327083 CCGGCCCCAAGCAACTCCTGAGG - Intronic
1091124628 11:133083250-133083272 CCCGGCTCAGGCAAAGCCCGCGG - Intronic
1202827347 11_KI270721v1_random:94697-94719 CAGGGCACAGGCACCTCCTGTGG + Intergenic
1094489925 12:30953537-30953559 TGGGGCTCAGGCCACACCTGTGG + Intronic
1096042305 12:48528344-48528366 CGGGGGCCAGGCAGCACCTGCGG - Intronic
1097756368 12:63410892-63410914 CCAGGTTCAGGCAACTCCTTTGG + Intergenic
1101626222 12:106444692-106444714 CCAGGCACTGGGAACACCTGAGG + Intronic
1103370241 12:120414012-120414034 CCGGGATCAGGCTAGAGCTGGGG - Intergenic
1105481312 13:20779328-20779350 CTGGGCTCAGAAAACACTTGAGG + Exonic
1106245305 13:27944645-27944667 CCAGGCCCAGAGAACACCTGGGG + Intergenic
1106559115 13:30833470-30833492 CCTGGCACTGGCAACCCCTGAGG + Intergenic
1112091860 13:96091030-96091052 CCGGGCTCAGGCGCCGCCGGAGG + Exonic
1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG + Intronic
1119323853 14:73746987-73747009 CTGGGGACAGGCAACCCCTGGGG + Intronic
1119549739 14:75499938-75499960 CCAGGCTCAGGCGTCATCTGTGG - Intergenic
1120881476 14:89417561-89417583 CCGGGCTCCGGCCACACGAGCGG + Intronic
1120940861 14:89947969-89947991 CAGGGGGCAGGCAATACCTGGGG - Intronic
1121743281 14:96268831-96268853 CCAGGCCCAGGCCACACCTGTGG + Intronic
1122207441 14:100155007-100155029 CCTGGCTCTGGCAACATCTAGGG + Intronic
1122588535 14:102827992-102828014 CCGGGCTCAGGTACGCCCTGCGG - Intronic
1122853249 14:104547937-104547959 CCAGCCTCTGGCCACACCTGGGG - Intronic
1123027388 14:105433147-105433169 CCGGGCTCAGGAGAGACCAGGGG + Intronic
1123934394 15:25187122-25187144 CTGGGCTCAGGCAAGACCCCCGG - Intergenic
1125045084 15:35236346-35236368 CCGCGCCCAGCCAACACTTGAGG - Intronic
1125894842 15:43293674-43293696 CTGGGCTCAGGCATCCCTTGTGG + Intronic
1127144536 15:56010860-56010882 CCGAGGTCAGGGATCACCTGAGG + Intergenic
1128695274 15:69757316-69757338 CTGGGCCCAGGCATCCCCTGGGG + Intergenic
1129191828 15:73941943-73941965 CCGGGCTCTGGCACATCCTGGGG + Intronic
1129871422 15:78944233-78944255 CCGGGCTCAGGCACCTCCCCTGG - Intronic
1130079516 15:80720254-80720276 CAGGACTCAGGGATCACCTGAGG + Intronic
1130933638 15:88450386-88450408 TCGGTCCCAGGCAATACCTGTGG - Intergenic
1131046888 15:89322156-89322178 CCTGGCTCAGCCAAGAACTGGGG + Intronic
1132285714 15:100660655-100660677 CCGGGCTCAGGCAATTCTTGTGG - Intergenic
1132589836 16:721812-721834 CCGGGCGGAGGCCGCACCTGTGG - Exonic
1133116550 16:3580893-3580915 CCCGGCTGAGGCAGCAGCTGGGG + Intergenic
1136290364 16:29267987-29268009 CAGGGCCCAGGCGACAACTGGGG + Intergenic
1139392334 16:66612774-66612796 CTGGGCTCAGGCAGAACCTGAGG - Exonic
1140958755 16:79892529-79892551 ACGTGCTCAGGAAACACCAGTGG + Intergenic
1141829879 16:86504291-86504313 GCCGGCTCAGGCGACACCTGCGG - Intergenic
1142096246 16:88241508-88241530 CAGGGCCCAGGCGACAACTGGGG + Intergenic
1142230592 16:88898416-88898438 CGGGGCTCTGTCACCACCTGGGG + Intronic
1146380406 17:32323358-32323380 CTGGGCTCAGGGAAGACCAGGGG + Exonic
1146647055 17:34582496-34582518 CCCGGCTGAGGTAACACCAGGGG + Intronic
1148155681 17:45424208-45424230 CCCGGCTCAGGCAACAGTTCTGG + Intronic
1150607411 17:66706126-66706148 ATGGGCTCAGGAATCACCTGGGG - Intronic
1151192299 17:72407418-72407440 GAGGGCCCTGGCAACACCTGTGG - Intergenic
1152321583 17:79610959-79610981 CCGGGCTCGGGCGGCAGCTGTGG + Intergenic
1157603338 18:48909201-48909223 ACAGGCTCAGTCATCACCTGAGG + Intergenic
1157697027 18:49731038-49731060 CCAGGCTCAGGTGACATCTGTGG + Intergenic
1159988697 18:74876701-74876723 CCTGGTTCAGGAAACACCTTTGG + Intronic
1160449238 18:78950776-78950798 CCGGTGTGAGGCATCACCTGGGG + Intergenic
1160632147 18:80254180-80254202 CAGGGCACAAGGAACACCTGGGG - Intergenic
1161291641 19:3496846-3496868 CCCTGCTCAGGCTAAACCTGGGG + Exonic
1161420748 19:4174875-4174897 CCCGGCTCATGAAGCACCTGGGG - Exonic
1161584233 19:5096479-5096501 ACGGGCTTGGGCAACCCCTGGGG + Intronic
1164629545 19:29753137-29753159 TCTGGCTCAGGCCACACCTCTGG - Intergenic
1165595393 19:37008195-37008217 CCCGCCCCAGGCAACTCCTGAGG - Intronic
1167207163 19:48110474-48110496 CCAGGCTCAGGCAAGCCGTGGGG - Exonic
1168102742 19:54149606-54149628 CCAGGCTCAGGGAACAACTCAGG + Exonic
1168455023 19:56500159-56500181 CCGGTTTCAGGCAACTCCTTAGG - Intergenic
925410648 2:3638090-3638112 CTGGGCTCAGTCTGCACCTGCGG + Intronic
925994045 2:9277272-9277294 CCAGGCTCAGCCAGCACCAGTGG - Intronic
926221932 2:10942156-10942178 CCAGGCTCAAGGAACACCTGGGG - Intergenic
927194245 2:20536949-20536971 CAGGGCTCAGGCACTGCCTGCGG - Intergenic
929003012 2:37366741-37366763 ACGGCCTCAGCCAACCCCTGCGG + Intronic
929040670 2:37741688-37741710 CAGTGCTCTGGGAACACCTGTGG - Intergenic
931172815 2:59822791-59822813 TCTGGCTCTGGCAACACCTCTGG - Intergenic
937155895 2:119718650-119718672 AGGGGCTCAGGCAGCACCTGGGG - Intergenic
937287563 2:120762818-120762840 CAGGGCTAAGGAGACACCTGAGG + Intronic
938157355 2:128952653-128952675 CCAGGTTCAGGCAGTACCTGAGG - Intergenic
1169141690 20:3230376-3230398 GTGGGCTCAGGCAAGGCCTGGGG - Intronic
1169216226 20:3796318-3796340 CCGGGCTCAGGCACCAGCCAGGG - Exonic
1170566520 20:17611073-17611095 CCGAGCTCAGGCAGCACCAGAGG - Intergenic
1171865463 20:30485303-30485325 CGGGGCACAGGCCACACCCGTGG + Intergenic
1172181700 20:33007739-33007761 CCTGTCTCAGGAACCACCTGAGG + Exonic
1173906639 20:46634504-46634526 CGGGGCTCAGGCATCTCCTGGGG - Intronic
1174426626 20:50436198-50436220 CCGGGTGCAGGCAACACGTGTGG + Intergenic
1174647938 20:52102184-52102206 CTGTGCTCAGGAATCACCTGGGG - Intronic
1176728506 21:10465650-10465672 CCAGGCCCATGCAGCACCTGAGG - Intergenic
1183367588 22:37415361-37415383 AGGGGCTCAGGCAACGGCTGTGG + Intronic
1184986789 22:48141334-48141356 CCGGGCTTTGCCAACATCTGTGG - Intergenic
953878275 3:46678702-46678724 CCAGGGACAGGCAACGCCTGAGG + Intronic
954401309 3:50321237-50321259 CCGGGCGCAGGCCCCACGTGTGG - Exonic
961322509 3:126085420-126085442 CCGAGTTCAGGCAACTCCTTTGG - Intronic
961452325 3:127007998-127008020 CCTGGCCCAGGGAGCACCTGTGG + Intronic
961565467 3:127760485-127760507 CCAGGCTCAGGCGCCACCTCTGG + Intronic
962266578 3:133948488-133948510 CCTGGCCCAGGCAAGCCCTGCGG + Intronic
964615220 3:158656584-158656606 CTTGGCTCAGCCAACACTTGAGG + Intronic
967824981 3:193870463-193870485 CGTGACTCAGGGAACACCTGGGG + Intergenic
969329253 4:6463577-6463599 CCGGGAGCAGGACACACCTGGGG - Intronic
973552660 4:52051439-52051461 CCGGGCTCAGGCGGCTGCTGGGG + Exonic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
982900958 4:161002780-161002802 CCTGGCTCAGGGAGCACCTAGGG + Intergenic
984185555 4:176538750-176538772 CCTTGCTCAGTCATCACCTGAGG + Intergenic
984845875 4:184107291-184107313 ACGGGCTCAGGCTGGACCTGTGG + Intronic
986425744 5:7629719-7629741 CGGTGCTCAGGAAACAGCTGCGG - Intronic
997388931 5:133497506-133497528 CCAAGCTCAGGCAGCTCCTGAGG + Intronic
997646016 5:135482639-135482661 CAGGCCTCAGGCAAGAACTGTGG + Intergenic
998336159 5:141374249-141374271 CCGTGCTCCGCCAACTCCTGGGG - Exonic
998483334 5:142480877-142480899 CTGGGCTTAGGCTAAACCTGTGG + Intergenic
999223966 5:150004589-150004611 CCGGTCTGAGGAATCACCTGAGG + Intronic
999486776 5:152004642-152004664 CAGGGATCAGGCAAGAGCTGGGG + Intergenic
1001167661 5:169385231-169385253 ATGTGCTCAGGCATCACCTGGGG - Intergenic
1006143582 6:31945308-31945330 CCTGGCTGAGGCAGCACCTGGGG + Exonic
1007380964 6:41489786-41489808 CCGGGCTCAGGGGACACTGGTGG + Intergenic
1013421058 6:109967443-109967465 CCTGGCTCAAGGAACACATGGGG + Intergenic
1015285878 6:131485830-131485852 CCAGGCTCAGGCAAGGACTGTGG + Intergenic
1015978852 6:138818812-138818834 GGGTGCTCAGACAACACCTGGGG + Intronic
1018635241 6:165854711-165854733 CCGGGCTCAGGCCAGGCCTCTGG - Intronic
1019308410 7:347216-347238 CAGGGATCAGGCAAGAGCTGGGG - Intergenic
1020080675 7:5284149-5284171 CGGGGCTGAGGGATCACCTGAGG + Intronic
1020430333 7:8111497-8111519 CCGGGCTCATGCAAAGCCGGTGG - Intergenic
1021569880 7:22053883-22053905 CCGGGCTCTGGCATCACCCAGGG + Intergenic
1025198251 7:56948025-56948047 CGGGGCTCAGGGATCACCTGAGG - Intergenic
1025673698 7:63628908-63628930 CGGGGCTGAGGGATCACCTGAGG + Intergenic
1029195549 7:98802842-98802864 CTGGGCTCAGGCCACATCAGGGG - Intergenic
1030666213 7:112281674-112281696 CCTGTTTCAGGGAACACCTGTGG - Intronic
1033245328 7:139712859-139712881 CAGGGCTCAGACAAGGCCTGAGG + Intronic
1034601586 7:152262310-152262332 CCAGGCCCATGCAGCACCTGAGG + Intronic
1035068013 7:156122065-156122087 CTGGGCTCAGGCAGTAGCTGAGG + Intergenic
1035442325 7:158911854-158911876 CCGGGCACAGGCAAAGCCGGAGG + Intronic
1035607815 8:940580-940602 CAGGGCTCTGGCAACAGCTGGGG + Intergenic
1036694904 8:10968006-10968028 CCGGGCTCAGGGGCCACCTGTGG + Intronic
1040514777 8:48125949-48125971 TTGGGCTCAGGCACCCCCTGTGG + Intergenic
1049312822 8:141942539-141942561 CCTGGCTCGGGCAAGTCCTGTGG + Intergenic
1049440604 8:142607818-142607840 GCGGCCTCAGGCCACACCTATGG - Intergenic
1049547524 8:143240453-143240475 GCTGGCACAGGCAACAGCTGTGG - Intergenic
1049686769 8:143942237-143942259 CCGAGCTCCGGAAACACCTGGGG - Intronic
1049717395 8:144099414-144099436 CCGAGCTCTGAGAACACCTGTGG + Exonic
1057138765 9:92714185-92714207 CTGGGCTCTGGATACACCTGTGG + Exonic
1057171207 9:92964369-92964391 CAGGGCTCGGCCAACACCTCAGG - Intronic
1061177832 9:129008249-129008271 CAGGGCTCTGGCAGCCCCTGGGG - Exonic
1187341491 X:18425485-18425507 GCGGGATCGGGCAAAACCTGAGG + Intergenic
1188358684 X:29225423-29225445 CTGGGCACTGGAAACACCTGAGG + Intronic
1189684689 X:43551752-43551774 CCGAGCTCAGTCATCAGCTGGGG - Intergenic