ID: 1113939792

View in Genome Browser
Species Human (GRCh38)
Location 13:114012656-114012678
Sequence CAGTGTGTGGGGAGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 1, 2: 6, 3: 84, 4: 855}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113939792 Original CRISPR CAGTGTGTGGGGAGTGTGGA AGG (reversed) Intronic
900177306 1:1296521-1296543 CAGCGTGTGCAGAGTGTGGCCGG - Exonic
900185459 1:1331213-1331235 CAGGGTGTGGCAAGTGAGGATGG + Intergenic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
900880576 1:5378286-5378308 GAGTGTGTGGGGAGTCTGCAGGG - Intergenic
901053500 1:6437714-6437736 CTGTGTCTAGGGAGTGGGGAGGG + Intronic
901163865 1:7201050-7201072 CTGGCGGTGGGGAGTGTGGATGG - Intronic
901293894 1:8145988-8146010 GAGGGTGTGGGGACTGTAGAAGG + Intergenic
901745962 1:11373634-11373656 GTGTGTGTGTGGTGTGTGGATGG + Intergenic
901745983 1:11373859-11373881 GTGTGTGTGGTGTGTGTGGATGG + Intergenic
901746037 1:11374355-11374377 TGGTGTGTGTGGTGTGTGGATGG + Intergenic
901796118 1:11680699-11680721 CAGTCTGTGGGAACTGGGGAAGG + Intronic
901843994 1:11970937-11970959 GAGGGTGTGGGGAGCGTGGGAGG + Intronic
901883089 1:12205303-12205325 CAGGGGGTGGGGAATGTGGCTGG + Intronic
901974704 1:12935263-12935285 TGTTGTGTGGGGAGTGGGGAGGG - Intronic
902010469 1:13266501-13266523 TGTTGTGTGGGGAGTGGGGAGGG + Intergenic
902332624 1:15738074-15738096 CAGTCTGTGGGGAGAGGGCACGG - Exonic
902480782 1:16710451-16710473 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
902670850 1:17972440-17972462 CAGAGTGTGGGGACTGAGCATGG - Intergenic
903015044 1:20356093-20356115 CAGGGGATGGGGAGTGTGCAGGG - Intergenic
903181762 1:21608452-21608474 GAATGAGTGGGGAGTGGGGAGGG + Intronic
904029471 1:27525254-27525276 CAGGGTGTGGGAAGTGTGTTAGG + Intergenic
904314355 1:29650656-29650678 CGGTGGGTGGGCAGGGTGGAGGG + Intergenic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904497272 1:30893973-30893995 CAGTGTGTGTGGTGTGTGTGTGG - Intronic
905014510 1:34768082-34768104 CAGTGTGTGGTGGGTGAGGAGGG - Intronic
905893247 1:41529980-41530002 AAGTGTGTGGTGTGTGTGCATGG - Intronic
905908283 1:41634391-41634413 CACTGTGTGGGGAGAGGGGAAGG + Intronic
906097858 1:43236248-43236270 CAGGGTGGGGGGTGTGTGGCAGG + Intronic
907090336 1:51718224-51718246 AAGTGTAGGGGGAGTGGGGATGG + Intronic
907274831 1:53311260-53311282 CAGGGTGTGAGGAGCGGGGAGGG + Intronic
907521927 1:55029520-55029542 GAGGATGTGGGGAGGGTGGATGG - Intergenic
908344268 1:63215576-63215598 CAGTGGGTGGGGGGTGGGTAGGG + Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
910183130 1:84506552-84506574 CAGTTTGTGGGAAGGGTTGAGGG + Exonic
910233198 1:85007946-85007968 CTCTGTGAGGGCAGTGTGGAAGG - Intronic
911276420 1:95864981-95865003 GAGTTTGTGGGGAGAGAGGAAGG - Intergenic
911699383 1:100933557-100933579 TAGAGTGGGGGGAGTGGGGAGGG - Intronic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912110540 1:106335373-106335395 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
912671492 1:111632085-111632107 CAGTCTGTGGGGAGTGGGGCAGG + Intronic
912907068 1:113718524-113718546 CTCTGTGAGGGTAGTGTGGAAGG - Intronic
913196271 1:116458793-116458815 GAGTGTGTGGGGTATGGGGAGGG - Intergenic
913331905 1:117674758-117674780 AAGTGTTTTGGGAGTGTAGAAGG - Intergenic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
915048247 1:153038599-153038621 CAGGGATTGGGGAGTGTGTAGGG - Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915932592 1:160069602-160069624 CACTGTATGGGGAGTGGGGGAGG + Intronic
916312592 1:163413388-163413410 CGATGTGTGTGGAGTGGGGAAGG + Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917262703 1:173187365-173187387 CAGAGTATGGGTAGTGTGCAGGG - Intronic
917649005 1:177058085-177058107 CAGTGTGTGGGGTGTGTGTATGG + Intronic
919464067 1:197911034-197911056 CAGTGGGGGGGGGGTGTGGGGGG - Intergenic
919977992 1:202625451-202625473 CAGTGTGCGGGGAGGGGGAAGGG + Intronic
920296288 1:204959213-204959235 CAGTGTGTGGGGACACTGCAAGG - Intronic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
922043035 1:221915763-221915785 AAGTGGGTGGGGAGTGTCAATGG - Intergenic
922618839 1:226978574-226978596 GAGTGTGTGGAGAGTGTGTAAGG - Intronic
922731305 1:227949932-227949954 GGGTGTGTGGGGGGTGGGGAGGG - Intergenic
923265174 1:232306992-232307014 GGGTGAGTGGGGAGTGGGGAAGG + Intergenic
923323155 1:232856563-232856585 CAGTGGGGAGGGAGTGTCGATGG - Intergenic
923453021 1:234137481-234137503 CAGTCTGTGGGGGTTGAGGAAGG + Intronic
923547212 1:234931583-234931605 GAGTGTGTGGGGGGAGTGGAAGG - Intergenic
923676624 1:236086167-236086189 TGGTGTTTGGGGAGTGGGGAGGG + Intergenic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
923979270 1:239302401-239302423 TGGGGTGGGGGGAGTGTGGAGGG + Intergenic
924333297 1:242962335-242962357 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
1063346314 10:5315307-5315329 CAGGGTCTGGGGTGTGTGGTTGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063578271 10:7281376-7281398 CAGTGGGAGGGGGGTGTGCAGGG - Intronic
1065087263 10:22191344-22191366 GAGTGTGTGGGGTGTGTGTGTGG - Intergenic
1065510990 10:26478332-26478354 CAGTGAGTGGGGCGGGAGGATGG + Intronic
1065828009 10:29589351-29589373 CAGTGTGGTGGGAATCTGGAGGG + Intronic
1065916578 10:30358455-30358477 CAGTGTGTGTAGGGTGTGGAGGG + Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1065949750 10:30641257-30641279 CAGTGTGACGGGAATCTGGAGGG - Intergenic
1066487981 10:35866640-35866662 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1066690216 10:38019126-38019148 CGGGGTGGGGGGAGTGGGGAGGG - Intronic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067421471 10:46154510-46154532 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067506808 10:46860961-46860983 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067660543 10:48233782-48233804 CACTGTGTGGGGAGGATGAAGGG - Intronic
1068826664 10:61447840-61447862 CAGAGTGAGGGGGGTGTGCAGGG - Intronic
1068866591 10:61901811-61901833 AAGTTTGTGGGGGGTGTGGGTGG - Intronic
1068967102 10:62923773-62923795 CAATGCAGGGGGAGTGTGGATGG + Intergenic
1070016448 10:72537271-72537293 TGGAGTGTGGGGAATGTGGATGG + Intronic
1070410311 10:76133544-76133566 CAATGTGTGGAGAGCGAGGAGGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070679600 10:78439340-78439362 GAGTGTGGTGGGAGTGGGGAGGG + Intergenic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070932407 10:80270718-80270740 CAGTGTTAGGGAAATGTGGACGG - Intergenic
1071038143 10:81272778-81272800 CAGAGGATGGGGAGTGTGGTGGG + Intergenic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071168666 10:82836883-82836905 TAGGGTGCGGGGAGTGGGGAGGG - Intronic
1071326517 10:84523999-84524021 CAGTGAGTGTTGAGTGGGGATGG - Intergenic
1071336167 10:84601888-84601910 GGGTGTGTGGGGAGTGTTCACGG - Intergenic
1071553774 10:86586699-86586721 CAGTGGGCGGGGAGAGTGGCAGG + Intergenic
1071863462 10:89700244-89700266 CAGTTAGTGGGGAGTGAGGTCGG + Intergenic
1072113075 10:92342137-92342159 CGGTTTGTGGGGAGTATTGAGGG - Intronic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1072641669 10:97215714-97215736 CAGGGCGTGGGGAGTGTTGGCGG + Intronic
1072713616 10:97734871-97734893 GAGTGGGTGGGGAGTGGCGATGG + Intergenic
1072740092 10:97904046-97904068 GAGTGTTTGTGGAGTGTGCAGGG - Intronic
1072740253 10:97904851-97904873 GAGTGTTTGTGGAGTGTGCAGGG - Intronic
1073284439 10:102379210-102379232 CAGTGAGTGGGGAGGGGGAAAGG + Intronic
1073301398 10:102473180-102473202 CAGGGTGTGGTGGGTGTTGAGGG + Intronic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074623040 10:115146609-115146631 CAGGGTGTGGGTAGTGGGGGAGG - Intronic
1074773021 10:116745474-116745496 CAGCCTGTGGAGGGTGTGGAGGG - Intergenic
1075065905 10:119288696-119288718 GTGTGTGTGGGGAGTGGGGGTGG + Intronic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075651250 10:124129355-124129377 AAGAGTGTGTGGAGTGGGGAAGG - Intergenic
1076078281 10:127554927-127554949 CAGGGTGTGTGGAGTGGGGCAGG + Intergenic
1076146463 10:128126212-128126234 CGGTGTGTGCGGAGCGTGGCGGG - Exonic
1076281361 10:129249484-129249506 GAGTGGGTGGGGTGTGTGCATGG + Intergenic
1076300087 10:129419213-129419235 CAGTGTGTGGGCAGTGTGGAGGG - Intergenic
1076545921 10:131245773-131245795 CAGTGGGTGGGAAGTGCGCACGG + Intronic
1078088927 11:8251758-8251780 GTGTGTGTGGTGTGTGTGGAGGG + Intronic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079125372 11:17714731-17714753 CATTTGGTGGGGAGTGGGGAGGG - Intergenic
1079153693 11:17924582-17924604 CACTGTGGTGGCAGTGTGGAGGG + Intronic
1079436703 11:20461235-20461257 CAGTAAGTTGGGAGTGGGGAGGG - Intronic
1081400375 11:42636087-42636109 CAGGGTGTGGGGGGTGTTGCAGG + Intergenic
1081780016 11:45703749-45703771 AAGTGTGTGGGAAATCTGGAAGG + Intergenic
1082618557 11:55393401-55393423 TGGGGTGGGGGGAGTGTGGAGGG - Intergenic
1082788064 11:57328239-57328261 CAGTGGGTGGGGGGCGTGGGAGG - Intronic
1083128721 11:60601115-60601137 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
1083257305 11:61504555-61504577 AAATGTGTGGGGGGTGGGGAGGG - Intergenic
1083502639 11:63124953-63124975 CGGGGTGGGGGGAGTGGGGAGGG + Intronic
1083752605 11:64769057-64769079 CAGTGTGTACCAAGTGTGGAGGG - Exonic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084173600 11:67412121-67412143 CAGTGTGTGGGGACTGAAGCTGG + Intronic
1084382993 11:68825531-68825553 CAGATTGTGGGTAGTGGGGACGG - Intronic
1084461665 11:69299670-69299692 GAGTGTGTGGGGGGTCTGGGTGG + Intronic
1084685855 11:70694837-70694859 CAGAGAGCGGGCAGTGTGGAAGG - Intronic
1084955174 11:72687406-72687428 CAGAGTGTGGGGTGTGGGGTGGG - Intronic
1085313814 11:75531451-75531473 CAGTGAGAGGAGAGTGTGCAGGG + Intergenic
1085479047 11:76806580-76806602 CCGTGTGTGGGGAGAGGGTAGGG + Intergenic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1086123451 11:83326023-83326045 CAGTGAGTTGGGTGAGTGGATGG + Intergenic
1086385944 11:86308710-86308732 TGGGGTGTGGGGAGTGGGGAGGG - Intronic
1086745012 11:90414190-90414212 CAGGGTGAGGGGAGAGGGGAGGG - Intergenic
1087195463 11:95300197-95300219 CAGGTAGTGGGGAGTGTTGAGGG + Intergenic
1087366903 11:97231721-97231743 CAGTGTTGTGGAAGTGTGGAGGG + Intergenic
1087675932 11:101161561-101161583 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
1087878378 11:103386641-103386663 TGGGGTGGGGGGAGTGTGGAGGG - Intronic
1087910201 11:103743539-103743561 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1087949062 11:104197740-104197762 TAATGTGTGGGGAGGGTGGGAGG - Intergenic
1088098262 11:106124724-106124746 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1088695360 11:112361709-112361731 CAGTGTGCAGAGAGTGTGGTGGG + Intergenic
1089063651 11:115645955-115645977 CGCTGCGTGGGGAGTGCGGAGGG + Intergenic
1089397881 11:118147693-118147715 CTGTTTGTGGGGGCTGTGGAGGG - Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1090007842 11:123018531-123018553 CAGTGTGTGCGGTGGTTGGAGGG + Intergenic
1090265294 11:125349660-125349682 AACAGTGTGGGGAGTGTGGTGGG - Intronic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1091028490 11:132162467-132162489 GTTTGTGTGGGAAGTGTGGATGG + Intronic
1091559971 12:1604802-1604824 GAGTGTGTGGGGTGTGTGTGGGG + Intronic
1092253815 12:6915690-6915712 CAGTGGGTGGGGGGTGGGTAGGG - Exonic
1092664876 12:10784941-10784963 TAGGGTGGGGGGAGTGGGGAGGG - Intergenic
1093080929 12:14810161-14810183 CCTTGGGTGGGGAGTGGGGAGGG + Intronic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095554085 12:43480312-43480334 CAGTGTGTGGGGGGTAAAGAAGG + Intronic
1095939852 12:47718884-47718906 CTGTTTGTTGGGTGTGTGGAGGG - Intronic
1096109422 12:49020280-49020302 CAGGGGGTGGGGAGTGGGGTGGG + Exonic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1097184971 12:57191714-57191736 TGGTGTGTGGGGGGTGTGTATGG - Intronic
1098378629 12:69844384-69844406 AATTGTGTGGCGGGTGTGGAGGG + Intronic
1098761869 12:74435033-74435055 CTCTGTGAGGGCAGTGTGGAAGG + Intergenic
1098805923 12:75020128-75020150 CAGGGAGTGGGGAGTGTGTCAGG + Intergenic
1099228869 12:80000400-80000422 CTGTATGGGGGGATTGTGGATGG - Intergenic
1099865670 12:88277831-88277853 CTGGGTGGGGGGAGTGTGGAGGG - Intergenic
1099886038 12:88532149-88532171 GAGTGAGTGGGGAGGATGGAGGG + Intronic
1100377891 12:94034371-94034393 CAGTGTGTAGGGGGTGGGGTGGG - Intergenic
1101434433 12:104652883-104652905 GAGTGTGTAGGGAGCGTGTAGGG - Intronic
1101492492 12:105222444-105222466 CAGGGTGTGGTGAGTGAGGAAGG + Intronic
1101519261 12:105466453-105466475 GAATCTGTGGGGACTGTGGAGGG - Intergenic
1101845962 12:108363178-108363200 GTGTGTGTGTGGAGTGTGGGGGG + Intergenic
1102003237 12:109571729-109571751 CAGTATCTGGTGAGTGGGGATGG + Intronic
1102145085 12:110649203-110649225 CAGTGTGGGGTGGGAGTGGATGG + Exonic
1103558484 12:121779812-121779834 CAGTGTGTGGGTGGAATGGAGGG + Exonic
1104372610 12:128237132-128237154 GGGTGGGTGGGGAGTGGGGAGGG - Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104908021 12:132225658-132225680 CAGTGTGTGGAGTGTGTGTGTGG - Intronic
1104908074 12:132225951-132225973 CAGTGTGTGGGGTGTGCATATGG - Intronic
1104908140 12:132226353-132226375 CAGTGTGTGGGATGTGTATATGG - Intronic
1104908197 12:132226685-132226707 CAGTGTGTGGGGTGGGTGTTTGG - Intronic
1104908208 12:132226746-132226768 CAGTGTGTGGGGTGGGTGTATGG - Intronic
1104908226 12:132226839-132226861 CAGTGTATGGGGTGTGTATATGG - Intronic
1104908237 12:132226911-132226933 CAGTGTGTGGGGTATGTATATGG - Intronic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105700673 13:22933505-22933527 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105853468 13:24355660-24355682 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105853511 13:24357126-24357148 GAGTGTGTGATGAGTGTGCACGG - Intergenic
1105989078 13:25600347-25600369 CTGTGAGTGAGGAGTGTGGTTGG + Intronic
1106299915 13:28454029-28454051 CTGGGTGGGGGGAGTGGGGAAGG + Intronic
1106421084 13:29586990-29587012 CAGGGTGTGTGGAGTCTGGGCGG + Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108676788 13:52743917-52743939 AAGGGTGTGGGAAATGTGGAGGG + Intergenic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1110345939 13:74448019-74448041 CACTGTGGGGTGTGTGTGGATGG + Intergenic
1110806366 13:79758774-79758796 TAGTGGGTGGGGTATGTGGATGG - Intergenic
1110996406 13:82115080-82115102 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1111926154 13:94464997-94465019 GAGGGTGAGGGGAGTGTGGGAGG - Intronic
1113039186 13:106085701-106085723 GTGTGTGTGGGGGGTGGGGAGGG + Intergenic
1113579182 13:111416895-111416917 CTCTCTGTGGGGCGTGTGGATGG - Intergenic
1113741381 13:112714470-112714492 CAGGGTTCGGGGAGTGAGGAGGG - Intronic
1113747266 13:112754062-112754084 CAGTGTTTTGGGATTGAGGAGGG + Intronic
1113939731 13:114012324-114012346 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1113939739 13:114012373-114012395 CGGTGCACGGGGAGTGTGGAAGG - Intronic
1113939744 13:114012393-114012415 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1113939782 13:114012602-114012624 GAGTGAGTGGGGAGTGTGCGTGG - Intronic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1113939804 13:114012723-114012745 GAGTGAGTGGGGAGTGTGTGTGG - Intronic
1113939813 13:114012774-114012796 GACTGCGTGGGGAGTGTGGAAGG - Intronic
1113939825 13:114012839-114012861 GAGTGAGTGGGGAGTGTGTGTGG - Intronic
1113939835 13:114012893-114012915 GACTGCGTGGGGAGTGTGGAAGG - Intronic
1113939847 13:114012958-114012980 GAGTGAGTGGGGAGTGTGTGTGG - Intronic
1113939852 13:114012987-114013009 GAGTGAGTGGGGAGTGTGTGTGG - Intronic
1113952035 13:114077466-114077488 CATTGAGTGGGGAGGGAGGAAGG - Intronic
1113987133 13:114326999-114327021 CGGTGGGTGGGGGGTGGGGATGG - Exonic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114409957 14:22491412-22491434 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1114535115 14:23417705-23417727 CAGAGGGTGGGGAGGATGGAGGG + Intronic
1115193262 14:30769686-30769708 ATATGTGTGGGGAGAGTGGAGGG - Intergenic
1115421767 14:33203462-33203484 TGGGGTGTGGGGAGTGGGGAGGG - Intronic
1115556190 14:34546656-34546678 CCGTGTGTTGAGAGTGTGGTGGG + Intergenic
1115557718 14:34556425-34556447 CCGTGTGTTGAGAGTGTGGTGGG - Intergenic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1116542267 14:46112920-46112942 CACTGTTAGGGCAGTGTGGAAGG + Intergenic
1116747294 14:48836897-48836919 GAGTGTGTGGGGGGAGGGGAGGG - Intergenic
1116934715 14:50727609-50727631 CTGTGTGTGGTGTGTGTGCATGG + Intronic
1117627672 14:57656293-57656315 GTGTGTGTGGGGGGTGTGGGGGG - Intronic
1118334406 14:64840695-64840717 AAGTGTGTGGGGATGGTGAAGGG - Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1119131793 14:72179645-72179667 CAGGGGGTGGGGGGTGGGGAAGG - Intronic
1119261227 14:73239099-73239121 CAGTGTGTGTGGAGTGTCTGTGG - Intronic
1119378587 14:74214466-74214488 CAGTGTCTGGGGACAGTGGTGGG - Intergenic
1119704014 14:76772971-76772993 CCGTCCGTCGGGAGTGTGGAGGG + Intronic
1120019616 14:79513637-79513659 CAGTCTGTCAGGAGAGTGGATGG + Intronic
1121110177 14:91307317-91307339 GCGAGTATGGGGAGTGTGGAGGG - Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121425148 14:93845354-93845376 CATGCTTTGGGGAGTGTGGAGGG + Intergenic
1121440478 14:93945691-93945713 GGGGGTGTGGGGAGTGGGGAGGG + Intronic
1121617164 14:95320434-95320456 CCCTGCGTGGGGAGTGTCGAGGG + Intergenic
1121629376 14:95411480-95411502 CAGAGAGTGGGGAGTGGGAAAGG + Intronic
1121633978 14:95441178-95441200 CAGTGTCTGTGGAATGTAGAAGG - Intronic
1121797104 14:96744272-96744294 GAGTGTGTGGGGGGTAGGGACGG + Intergenic
1122291526 14:100682797-100682819 GAGTGTGTGTGGAGTTGGGAGGG - Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122842231 14:104471601-104471623 GCGTGTGTGGGGAGTGGGGATGG - Intergenic
1123095760 14:105766329-105766351 CAGTGTGGGGGGAGAGTGTTGGG + Intergenic
1123477087 15:20597877-20597899 CATCTTGTGGGGAGAGTGGATGG + Intergenic
1123640926 15:22402487-22402509 CATCTTGTGGGGAGAGTGGATGG - Intergenic
1123662598 15:22577534-22577556 CAGAGTGTGGGGGTTGTGAAAGG + Intergenic
1123945987 15:25239140-25239162 CTGTGTGTGGGAGGTGTGCAGGG + Intergenic
1124235163 15:27983821-27983843 CAGTGTGGAGGCAGTGCGGATGG + Intronic
1124261683 15:28198377-28198399 CAGAGTGTGGGGGTTGTGAAAGG - Exonic
1124316400 15:28671835-28671857 CAGAGTGTGGGGGTTGTGAAAGG + Intergenic
1124493600 15:30173375-30173397 CAGTGTGCGGGGAGGGGGAAGGG + Intergenic
1124563286 15:30794409-30794431 CACTGTGTGAGGAGGATGGAGGG - Intergenic
1124648733 15:31459021-31459043 CTCAGTGTGGCGAGTGTGGAAGG - Intergenic
1124749968 15:32365274-32365296 CAGTGTGCGGGGAGGGGGAAGGG - Intergenic
1125214739 15:37258445-37258467 GGGTTGGTGGGGAGTGTGGATGG + Intergenic
1125393683 15:39224254-39224276 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1125476441 15:40050942-40050964 GAGTGTGTGGTGTGTGGGGAGGG + Intergenic
1127281911 15:57500094-57500116 CTGGGTGTGGGGAGTGGGAATGG + Intronic
1127531006 15:59843563-59843585 AAGTGTGTGGGGAGAGCGGTGGG + Intergenic
1128737373 15:70060816-70060838 CAGTCTCAGGGGAGTGGGGAAGG - Intronic
1128929688 15:71693109-71693131 CAGGATGTGGGGAGGGTGGGGGG + Intronic
1128941315 15:71790173-71790195 GAGTGTGTCGGGAGGGTGCAGGG - Intergenic
1129210423 15:74064914-74064936 CAGTGTGTGTGGGCTGGGGAGGG + Intergenic
1129403591 15:75300459-75300481 CAGTGTGTGTGGGCTGGGGAGGG - Intergenic
1129700207 15:77763407-77763429 CAGTGACTGGGGAGAGGGGATGG - Intronic
1129881870 15:79012176-79012198 CGGTGTTTGGGGAGAGTGCAGGG - Intronic
1129883702 15:79023896-79023918 CTGTGTGTGGTGTGTGTGAAGGG - Intronic
1129884440 15:79028667-79028689 CAGGGTCTGGGGAGTGGGGAAGG + Intronic
1129934453 15:79437780-79437802 TAGTGTGTGGGGTGTGGGGTTGG + Intronic
1129934552 15:79438122-79438144 GAGTGTGTGGGGTGTGGGGCTGG + Intronic
1129934597 15:79438285-79438307 GAGTGTGTGGGGTGTGGGGCTGG + Intronic
1129934645 15:79438469-79438491 TAGTGTGTGGGGTGTGGGGTGGG + Intronic
1129934655 15:79438496-79438518 TAGTGTGTGGGGTGTGGGGTGGG + Intronic
1129934705 15:79438663-79438685 CATAGTGTGTGGGGTGTGGATGG + Intronic
1129934846 15:79439150-79439172 GAGTGTGTGGGGTGTGTGTGGGG + Intronic
1130052540 15:80495800-80495822 CAAGGTGTGGGGAAAGTGGAAGG - Intronic
1130258635 15:82337571-82337593 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1130270050 15:82441513-82441535 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1130415983 15:83695076-83695098 TAGTGTGTGGGGTGTGTGTGTGG + Intronic
1130468289 15:84203721-84203743 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130481418 15:84361816-84361838 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1130485460 15:84396021-84396043 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130490287 15:84425959-84425981 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1130495977 15:84469821-84469843 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130537749 15:84799135-84799157 CAGGCTGTTGGGGGTGTGGAAGG - Exonic
1130590582 15:85208319-85208341 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130596288 15:85252389-85252411 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1131341404 15:91605136-91605158 CTGTCTGTGGGGAGTGATGAGGG + Intergenic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1132120245 15:99169579-99169601 CAGTGAGCAGGGAGTGGGGAGGG + Intronic
1132185373 15:99798507-99798529 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1132431617 15:101766021-101766043 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1132431644 15:101766123-101766145 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1132479353 16:159399-159421 GAGTGAGTGGGGGGTGTCGAGGG + Intronic
1132664758 16:1076291-1076313 CAGGGTGTGGGGAGAGAGGGAGG - Intergenic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132941847 16:2512423-2512445 GAGTGTGTGGAGAGGGTGGCAGG + Intronic
1133060916 16:3174188-3174210 CAGCGAGAGGGGAGTGTGTATGG - Intergenic
1134197534 16:12170458-12170480 CAGTGGGGGAGGCGTGTGGATGG + Intronic
1136406859 16:30053247-30053269 CGGAGTGTGGGGACTGAGGAGGG + Intronic
1136631824 16:31493409-31493431 CGGAGTGAGGGGAGTGTGGGTGG + Intronic
1137289423 16:47041860-47041882 GAGTGTGTGGGCGGGGTGGAGGG - Intergenic
1137732414 16:50698390-50698412 GTGTGTGTGGGAAGTGTTGATGG + Intronic
1138069082 16:53972806-53972828 CAGTGTTTGTGGAGAGTGCAGGG + Intronic
1138412961 16:56854069-56854091 AAGTGTGTGGCGGGTATGGAGGG + Intergenic
1138477190 16:57278596-57278618 CAGTAAGTGGGGAGTGTGGGGGG + Intronic
1139722724 16:68869925-68869947 CAGTGAGTGGGGATGGTGGCTGG + Intronic
1140200039 16:72887628-72887650 CAGTGTGTGTGGGGTGTGTGGGG + Intronic
1141167226 16:81668829-81668851 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167231 16:81668856-81668878 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167241 16:81668903-81668925 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167252 16:81668950-81668972 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167257 16:81668972-81668994 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167263 16:81668999-81669021 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167269 16:81669024-81669046 GAGAGTGTGGTGGGTGTGGAAGG - Intronic
1141167410 16:81669652-81669674 GAGTGTGAGGTGGGTGTGGAAGG - Intronic
1141261926 16:82462223-82462245 AAGTGTGTGGGCAGGGTGTAGGG + Intergenic
1141638897 16:85329840-85329862 GAATGTGTGGGGAGGGCGGAGGG + Intergenic
1141787669 16:86212746-86212768 CAGTCTGTGTGGTGTGAGGAAGG - Intergenic
1142213696 16:88820836-88820858 CAGCCTGTGGGGGGTGTGGCGGG + Intronic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1142698657 17:1646859-1646881 AAGAGTGTGGGGAGGGAGGAAGG - Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143953823 17:10653713-10653735 CTGTCTCTGGGCAGTGTGGATGG + Intronic
1144003572 17:11078232-11078254 CAGTGTATGGAGGGAGTGGATGG + Intergenic
1144013147 17:11169517-11169539 CGGTGTGTGGAGAGAGGGGAAGG - Intergenic
1144479981 17:15621290-15621312 CCGTGTGTGTGCAGTGTTGAGGG - Intronic
1144619339 17:16806973-16806995 CAGTGTGTGTGGCGAGTGTATGG + Intergenic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1144893354 17:18508732-18508754 CAGTGTGTGTGGCGAGTGTATGG - Intergenic
1144918320 17:18742456-18742478 CCGTGTGTGTGCAGTGTTGAGGG + Intergenic
1145015037 17:19391050-19391072 CAGTGTGTGGGGACTCTACAAGG - Intergenic
1145961043 17:28886705-28886727 CAGGCTGTGGACAGTGTGGAAGG + Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146750368 17:35373411-35373433 CAGGGTGTGGGGTGTGGGGAGGG - Intronic
1146852151 17:36231441-36231463 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1146868060 17:36355312-36355334 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1146925428 17:36741143-36741165 CAGTGGGTGGGGTGTGTGCTGGG + Intergenic
1146925510 17:36742342-36742364 CAGTGTCTGTGCGGTGTGGATGG + Intergenic
1147070934 17:37955930-37955952 CGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1147082460 17:38035456-38035478 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1147098404 17:38159423-38159445 CGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1147650738 17:42060461-42060483 CAGTGTGCTGGGTGTGTGCAGGG - Intronic
1147757513 17:42778805-42778827 GAGTGCCTGGGAAGTGTGGATGG + Intronic
1147847055 17:43411831-43411853 CAGGGGGTGGGGGGTGTGGATGG + Intergenic
1148234149 17:45956216-45956238 CAGTGTGTGGGCAGTGGGCTGGG + Intronic
1148534584 17:48429344-48429366 CAGTGTGTGTTGAGTGTTGACGG + Intronic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148828981 17:50416888-50416910 CAGTCTGAGGGGAGTCAGGAGGG + Intergenic
1150075758 17:62190733-62190755 GACTGTGTGTGGAGAGTGGAGGG + Intergenic
1150092644 17:62342215-62342237 CATAGTGTGGGGAGTGTGGTGGG + Intergenic
1150132174 17:62675159-62675181 ATTTGTGTGGGGAGTGTTGAGGG + Intronic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1150533053 17:66006221-66006243 CATGGTGCGGGGAGTGGGGAGGG - Intronic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151212270 17:72553560-72553582 GGGTGTGTGGGGGGTGTGCATGG - Intergenic
1151212333 17:72554019-72554041 GTGTGTGTGGGGTGTGTGCATGG - Intergenic
1151382437 17:73735098-73735120 GAGTGTGTGGCGAGTGGGGATGG - Intergenic
1151599778 17:75099088-75099110 GAGTGGGTGGGGAGCGGGGAAGG + Intronic
1152044727 17:77928440-77928462 CAGGGTGTGGGGAGGGTAGTGGG + Intergenic
1152067075 17:78117781-78117803 CAGTGAGTGGGGCGGGTGGAGGG - Exonic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152328979 17:79659622-79659644 CAGTCTCTGGGGAGTGGGGAGGG - Intergenic
1152601004 17:81262144-81262166 CAGTCAGTGGGTGGTGTGGATGG + Intronic
1152733422 17:81984839-81984861 GTGTGTGTGGGGTGTGTGCAGGG - Intronic
1152760149 17:82103473-82103495 CAGTGTGGGGGGTGGGGGGAGGG - Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1154004207 18:10512978-10513000 CTGTGTGTGGTGTGTGTGGGTGG + Intergenic
1154149320 18:11893788-11893810 CAGTGTCTGGGGTGTGTGGAAGG - Intronic
1154961150 18:21309899-21309921 CAGTGTGTGTGGGGAGGGGATGG - Intronic
1155159419 18:23183548-23183570 CAAAGTGTGGCCAGTGTGGAAGG + Intronic
1155427556 18:25722455-25722477 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1156132013 18:33987932-33987954 TAGTGTATGTGGAGTGGGGAGGG - Intronic
1157091493 18:44642191-44642213 CATTCTGTGGAAAGTGTGGAAGG + Intergenic
1157422048 18:47555676-47555698 CAGGGTGGGGGATGTGTGGAAGG - Intergenic
1157622470 18:49024326-49024348 CAGGGAGTGTGGAGTGGGGAGGG + Intergenic
1157700915 18:49761266-49761288 GAGTGTGTGGGGTCTGTGTAGGG - Intergenic
1157700932 18:49761341-49761363 GGGTGTGTGGGGTGTGTGGAGGG - Intergenic
1157700981 18:49761528-49761550 GGGTGTGTGAGGTGTGTGGAAGG - Intergenic
1158038806 18:53068410-53068432 CAGTTTGTGGGGTGGGGGGAGGG - Intronic
1159151286 18:64526963-64526985 AAGTGTGTTGGGAGTGGGGCAGG - Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1160400402 18:78606687-78606709 GTGTGTGTGGGGTGTGTGTATGG - Intergenic
1160420149 18:78738443-78738465 CTGTGTGTGGGGACTGTGTGTGG - Intergenic
1160420278 18:78739240-78739262 CTGTGTGTGGGGACTGTGTGTGG - Intergenic
1160514862 18:79472640-79472662 AAGTGTGTGGGGTGAGGGGAGGG - Intronic
1160665756 19:327396-327418 CAGCGTGGGGGGAGCGGGGATGG + Intronic
1161326377 19:3666087-3666109 CGGCGTGGGGGCAGTGTGGAGGG - Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162663957 19:12194455-12194477 AAATGTGTGGGGATTGGGGAAGG + Intergenic
1162736135 19:12748143-12748165 GAGGGGGTGGGGAGGGTGGAGGG - Exonic
1162850826 19:13429980-13430002 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163145626 19:15377861-15377883 TAGTGGGCGGGGGGTGTGGAGGG - Intronic
1163188819 19:15660401-15660423 CAGTGTCTGTGGAGTTTGCAGGG - Exonic
1163763707 19:19150794-19150816 GAGTGGGTGGAGAGTGGGGAGGG + Intronic
1164428007 19:28160794-28160816 CACTGTGGGGGGAGTTTTGATGG - Intergenic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165698456 19:37919071-37919093 CAGTGGATGGGGTGTGGGGAAGG + Intronic
1165703224 19:37954479-37954501 CAGCGGGTGGGCAGTGGGGAAGG + Intronic
1165898983 19:39159844-39159866 CAGCGTCTGTGGAGGGTGGAGGG - Intronic
1166246117 19:41527785-41527807 CAGTGTGTGGGAAGTGTGCTTGG - Intergenic
1166328889 19:42067511-42067533 CAGAGTGGGAGGAGTGTGAAGGG + Intronic
1166765214 19:45248800-45248822 GAGTGTGTGGGGCGCGTGTAGGG + Intronic
1167068290 19:47203694-47203716 CAGTGTGTGCGGTGGTTGGAGGG + Exonic
1167095579 19:47373421-47373443 CAGTTTGTGGGTAGTCTGGGAGG + Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167991428 19:53364571-53364593 CTTTGTGAGGGGAGTGTGGCAGG - Intergenic
1168116015 19:54221760-54221782 CAGGTTGTGGGGAGTTTGGCTGG - Intronic
1168118997 19:54241508-54241530 CAGGTTGTGGGGAGTTTGGCTGG - Intronic
1168145275 19:54416742-54416764 CCGTGTGTGGGGAGAGGGGGCGG - Intronic
1168185546 19:54697560-54697582 CAGGTTGTGGGGAGTTTGGCTGG + Intronic
1168305842 19:55434961-55434983 GTGTGTGTGGTGTGTGTGGATGG + Intronic
1168308302 19:55448242-55448264 CAGTGTGTGGTGTGTGTGTGTGG - Intergenic
1168308329 19:55448456-55448478 CAGTGTGTGGTGTGTGTGTGTGG - Intergenic
1168308337 19:55448528-55448550 CAGTGTGTGGTGTGTGTGTGTGG - Intergenic
1168308368 19:55448825-55448847 CAGTGTGTGGTGTGTGTGTGTGG - Intergenic
1168308374 19:55448902-55448924 CAGTGTGTGGTGTGTGTGTGTGG - Intergenic
1168561429 19:57387059-57387081 CAGTGGGTGGGGAGTGTATCAGG - Intronic
1202647145 1_KI270706v1_random:152943-152965 CAAGATGTGGGGAGTGTGGGCGG + Intergenic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
1202714819 1_KI270714v1_random:36356-36378 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
925329257 2:3045439-3045461 CACTGTGTGGGTAGTGGGGACGG + Intergenic
925348747 2:3187540-3187562 TGGTGGGTGGGGAGTGGGGAGGG - Intergenic
925348916 2:3187974-3187996 AGGTGAGTGGGGAGTGGGGAGGG - Intergenic
925914767 2:8596846-8596868 CTGTGTGTGGTGTGTGTGGCAGG + Intergenic
925976279 2:9144260-9144282 CAGTGTGTGGTGTGTGTGTGTGG - Intergenic
926119357 2:10233655-10233677 GAGTGTGTGGTGAGTGTGAGTGG + Intergenic
926152859 2:10434510-10434532 TAGTGTGTGGGGGATGGGGAGGG + Intergenic
926307613 2:11650231-11650253 CAGGGAGTGGGGTGTGTTGAGGG + Intergenic
926674466 2:15609054-15609076 AAGTGTGGGGATAGTGTGGAGGG + Intronic
927341884 2:21992256-21992278 CTTTGTGAGGGCAGTGTGGAGGG - Intergenic
927383887 2:22510878-22510900 AAGAGGGTGGGGACTGTGGAGGG - Intergenic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928676536 2:33656698-33656720 TAGGGTGAGGGGAGTGGGGAGGG + Intergenic
929576730 2:43056967-43056989 CAGGGTGTGGGGGCTGGGGAGGG - Intergenic
930338802 2:50084589-50084611 CAGCCTGCGGGGGGTGTGGAGGG - Intronic
930462211 2:51695673-51695695 CAGTGTGTGGGCAGTGTAATTGG + Intergenic
931244287 2:60479607-60479629 CAGGCGGTGGAGAGTGTGGACGG + Intronic
931448867 2:62350689-62350711 CATTCTCTGTGGAGTGTGGAGGG - Intergenic
931514993 2:63045179-63045201 CAGTGAGTGGGCAGTGGGGTCGG + Exonic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
932928482 2:76004721-76004743 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
934868987 2:97842555-97842577 CAGTGTTGGGGGAGAGTGGAGGG + Intronic
935798547 2:106669572-106669594 GAGAGTGTGGGGACTGAGGAAGG - Intergenic
935820052 2:106885967-106885989 CCGTGTGTGGGGAATGTTGAAGG - Intronic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
936150957 2:110022269-110022291 CACTGGGTTGGGTGTGTGGATGG - Intergenic
936193719 2:110349100-110349122 CACTGGGTCGGGTGTGTGGATGG + Intergenic
936917517 2:117655049-117655071 TAGGGTGGGGGGAGGGTGGAGGG + Intergenic
937305395 2:120867575-120867597 CAGCGTGCGGGGAGGGCGGAGGG - Intronic
937895593 2:126974765-126974787 GAGTCTGTGGGGGCTGTGGAGGG - Intergenic
938240704 2:129740662-129740684 CAGAGTGTGGGCAGTGTCCAAGG + Intergenic
938399478 2:130977014-130977036 CAGTGTGTGTTAAGTGTGAATGG + Intronic
939529789 2:143343555-143343577 CACTGTGTTGGCAGTGTGGGGGG + Intronic
940113279 2:150179475-150179497 TGGGGTGTGGGGAGTGGGGAGGG - Intergenic
940455017 2:153886353-153886375 CGGGGTGGGGGGAGTGGGGAGGG - Intronic
940701880 2:157055039-157055061 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
941162974 2:162055934-162055956 CACTGGGTGGCCAGTGTGGATGG - Intronic
941270094 2:163414652-163414674 CAGTGTTTGGGGCTTGGGGAAGG + Intergenic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
941973023 2:171372624-171372646 TGGGGTGTGGGGAGTGGGGAGGG - Intronic
942511503 2:176707847-176707869 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
942943112 2:181643089-181643111 CACTGTCTGGTGTGTGTGGAGGG - Intronic
943578510 2:189657972-189657994 CAGGATGTGGTGAGTGTGGTAGG - Intergenic
943789586 2:191917344-191917366 TTGTGTGTGGGGAGTGAGGGGGG + Intergenic
943999313 2:194811884-194811906 CGGGGTGTGGGGAGGGGGGACGG + Intergenic
944318271 2:198306858-198306880 CTGTGCCTGGGGAGTGTGTAGGG - Intronic
944480732 2:200154777-200154799 CAATGTGTGGGGAATGAGGGGGG - Intergenic
944868596 2:203886699-203886721 CGGTTTGTGTGGAGTGGGGAAGG - Intergenic
945297327 2:208183559-208183581 CAGTGTGGTGGGAATTTGGAGGG + Intronic
945355776 2:208837573-208837595 GAGTGAGGGGGGAGTGGGGACGG + Intronic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
946251107 2:218413087-218413109 CAGTTTGTGGGAAGTGCAGAAGG + Intergenic
946431960 2:219630915-219630937 CAGTGTGTGGGTGGGGTGGGGGG + Intronic
946661339 2:222003250-222003272 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
947049886 2:226030642-226030664 CTGTGTGTGGGGGGTGGGGTGGG + Intergenic
947505595 2:230706123-230706145 GAGGGTGTGGGTAGGGTGGAAGG + Intergenic
947734787 2:232448922-232448944 CAGAGGGTGGGCAGCGTGGAGGG - Intergenic
948367136 2:237464015-237464037 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
948379363 2:237542041-237542063 GAGAGTGTGAGGAGGGTGGACGG + Intronic
948401036 2:237685665-237685687 CTGGGTGTGGGGAGCGGGGAGGG - Intronic
948563816 2:238871047-238871069 TTGTGTGTGGGGTGTGTGGTGGG - Intronic
948563935 2:238871624-238871646 TTGTGTGTGGGGTGTGTGGTGGG - Intronic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1169709709 20:8548022-8548044 GAGTGTGTGGGTGGTGAGGAAGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1171559622 20:26111567-26111589 TGGTGTGTGGGGAGTGGGGAGGG - Intergenic
1171756131 20:29111544-29111566 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
1172281572 20:33711467-33711489 GAGTTTGTGGGGAGGGTGCAGGG + Intronic
1172646701 20:36474731-36474753 CAGTGTGTGGGAAGGGTGGGGGG + Intronic
1172782776 20:37447135-37447157 CAGTGTGTGTGGTGTGTGAAAGG + Intergenic
1172878091 20:38178290-38178312 CAGGCTCTGGAGAGTGTGGAGGG + Intergenic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1173866211 20:46314068-46314090 GTGTGTGTGGGGAGTGTGGTAGG - Intergenic
1174033429 20:47650033-47650055 CAGTGTGTTGGGGTGGTGGAGGG - Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174332725 20:49832589-49832611 CCGTGAGTGGGGAGAGGGGAAGG - Intronic
1175219484 20:57408825-57408847 CAGTGTTTGGGGAGTTGGGGAGG - Exonic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175597612 20:60247738-60247760 CAGTGTTTGGGGAGAATGGTAGG + Intergenic
1175943644 20:62549103-62549125 GCGTGTGTGGCGAGTGTGGCTGG + Intergenic
1175949183 20:62573857-62573879 CAGTGTGTGGGCTGTGTGCCTGG + Intergenic
1176245046 20:64093490-64093512 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245092 20:64093622-64093644 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245105 20:64093669-64093691 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245113 20:64093693-64093715 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245148 20:64093808-64093830 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245157 20:64093833-64093855 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245160 20:64093844-64093866 CAGTGTGTGGGGACAGTGTGGGG + Intronic
1176245177 20:64093891-64093913 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245187 20:64093917-64093939 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245190 20:64093928-64093950 CAGTGTGTGGGGACAGTGTGGGG + Intronic
1176245210 20:64093986-64094008 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245236 20:64094067-64094089 CAGAGTGGGGGCAGTGTGGGGGG + Intronic
1176245259 20:64094125-64094147 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245266 20:64094160-64094182 CAGTGTGCGGGCAGTGTGTGGGG + Intronic
1176245281 20:64094197-64094219 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245341 20:64094393-64094415 CAGTGTGCGGGCAGTGTGTGGGG + Intronic
1176245367 20:64094464-64094486 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245391 20:64094534-64094556 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245400 20:64094559-64094581 CAGTGTGGGGGCAGTGTGTGGGG + Intronic
1176245408 20:64094595-64094617 CAGTGTGCGGGCAGTGTGTGGGG + Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176304921 21:5118314-5118336 GAGTGTGTGCGAGGTGTGGAGGG - Intronic
1176429201 21:6565610-6565632 GAGTGTGTGGAGTGTGTGGTGGG - Intergenic
1176429221 21:6565779-6565801 GAGTGTGTGGTGTGTGTGGTGGG - Intergenic
1176604725 21:8819831-8819853 CAAGATGTGGGGAGTGTGGGCGG - Intergenic
1177175549 21:17697729-17697751 CAAGCTGTGGGGAGTGTGGGTGG + Intergenic
1178134199 21:29608336-29608358 GAGTGTGTGTGGAGTATAGAAGG + Intronic
1178347887 21:31847740-31847762 CAGTTGGTGGGGAGTGTTGAAGG - Intergenic
1178753531 21:35326327-35326349 CAGTGTGGGGCAGGTGTGGAGGG + Intronic
1178893420 21:36539389-36539411 GAGTGTGTGTGGAGTGTGTGTGG + Intronic
1178893430 21:36539538-36539560 GAGTGTGTGTGGAGTGTGTGTGG + Intronic
1178956448 21:37026668-37026690 CAGACTGTGGAGAGTGGGGAAGG - Intergenic
1179769582 21:43604542-43604564 CAATGTGTGTGGGGTGTGTATGG - Intronic
1179852133 21:44143716-44143738 GAGTGTGTGCGAGGTGTGGAGGG + Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179936402 21:44607827-44607849 GAGTGTGTGGGGCATGTGAAGGG - Intronic
1179998269 21:44983991-44984013 GAGTGTGTGGGGTGTGGGGAGGG - Intergenic
1179998383 21:44984394-44984416 CAGTGTTGGGGGTGTGTGGGGGG - Intergenic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180228578 21:46412989-46413011 CAAGGTGTGGGGAGGGGGGAAGG + Exonic
1180228597 21:46413049-46413071 CAAGGTGTGGGGAGCGGGGAAGG + Intronic
1180228615 21:46413109-46413131 CAAGGTGTGGGGAGCGGGGAAGG + Intronic
1180228633 21:46413169-46413191 CAAGGTGTGGGGAGCGGGGAAGG + Intronic
1180228690 21:46413348-46413370 CAAGGTGTGGGGAGGGGGGAAGG + Intronic
1180347015 22:11711436-11711458 CAAGATGTGGGGAGTGTGGGCGG - Intergenic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1180606360 22:17061829-17061851 GAATGTGTGGGGAGAGTGGGAGG - Intergenic
1181401488 22:22652576-22652598 GAGTGTGTGGGGGGTGTGGGGGG + Intergenic
1181465150 22:23106924-23106946 CCCTGTGTGTGCAGTGTGGAGGG - Intronic
1181921952 22:26327551-26327573 GTGTGTGTGGGGTGTGTGTATGG - Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182145341 22:27993781-27993803 CTGTCTGCGGAGAGTGTGGAAGG - Intronic
1182273418 22:29170049-29170071 GGGTGGCTGGGGAGTGTGGAGGG + Intergenic
1182422149 22:30253868-30253890 CACTGGGTGGGGAGGATGGAGGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183342024 22:37286769-37286791 CAGTGTGAGAGGAGCATGGAGGG + Intronic
1183587587 22:38761884-38761906 GTGTGTGTGGGGAGTGTGTGTGG + Intronic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1183708478 22:39489052-39489074 GAGTGGGTGGGGAGTGGGGGTGG + Exonic
1184073396 22:42161114-42161136 CAATGTGGGGGGAGGGGGGAGGG - Exonic
1184263897 22:43336342-43336364 CGGAGTGTGGGGTCTGTGGAAGG - Intronic
1184365242 22:44046957-44046979 CGGTGTGCGGGGGGTGGGGATGG + Intronic
1184372130 22:44089378-44089400 CAGTGTCTGGAGGGTGTGGAGGG - Intronic
1184572423 22:45334310-45334332 TAGTGTGTGGTGAGTGTGCCTGG - Intronic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184606546 22:45577708-45577730 CGGTGTTTGGGGAGCGTGAAGGG + Intronic
1185052472 22:48561068-48561090 AGGTGGGTGGGGACTGTGGATGG + Intronic
1185233581 22:49698607-49698629 CAGAGTGAGGGGAGTGCTGAGGG + Intergenic
1185351194 22:50340236-50340258 GTGTGTGTGGTGTGTGTGGAGGG + Intergenic
949831181 3:8216155-8216177 AAATGTGTGGGGGGTGTGGGGGG + Intergenic
950110376 3:10414813-10414835 AAGTCTGTGGGGAGTGGGCAAGG - Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950421428 3:12901879-12901901 CTGTGTGTGGCGAGTGCAGAGGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950880171 3:16316967-16316989 CTGTGTGGGGTGGGTGTGGAGGG - Exonic
951945459 3:28130984-28131006 CAGTGAGTGAGGAGAGTGGTAGG - Intergenic
952216915 3:31287375-31287397 CAGTGTGTGGGGGCTGTGGGTGG + Intergenic
952531649 3:34268552-34268574 CAGGGCGGGGGGAATGTGGATGG - Intergenic
952686766 3:36159148-36159170 CAGTGTGTGGGGCCTGGGGGAGG - Intergenic
952851304 3:37732201-37732223 CAGGGTGTGGGGAGGGTACAAGG - Intronic
953046868 3:39301344-39301366 CAGTGGGTGGGAAGTGTGTTGGG + Intergenic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
953568307 3:44051768-44051790 CAGTGGGTGGTGCCTGTGGAGGG - Intergenic
954088860 3:48269022-48269044 ATGTGTGTGGGGAATGTGGGCGG + Exonic
954088917 3:48269442-48269464 ATGTGTGTGGGGAATGTGGGCGG + Exonic
954345669 3:49996033-49996055 CAGGGTGTGGGAAGTGGGGAGGG - Intronic
954369303 3:50161904-50161926 AAGTGTGTGTGGAGTGAGAATGG + Intronic
954755183 3:52835349-52835371 CAGTGTGTGGGGTGGGTGTGGGG + Exonic
954798105 3:53171827-53171849 CAGGGAGTGGGCAGTCTGGAAGG + Intronic
955482221 3:59401452-59401474 TAGGGTGTGGGGAGTTGGGAGGG + Intergenic
955483968 3:59417318-59417340 AAGTGTGAGGGTAGTGTAGAGGG - Intergenic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957079967 3:75628936-75628958 CAGTGTTTGGGTCGTGGGGACGG + Intergenic
957480819 3:80791231-80791253 TGGGGTGTGGGGAGTGGGGAGGG - Intergenic
957806853 3:85158691-85158713 TGGGGTGTGGGGAGTGGGGAGGG + Intronic
958201433 3:90321319-90321341 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
958574423 3:95929617-95929639 CAGGGTGTGGGAGGTGGGGAAGG - Intergenic
958870997 3:99559135-99559157 CAGTGTGTGGGGTCGGGGGAGGG - Intergenic
959056695 3:101574340-101574362 CAGGGTGGGGGGAGTGGGGTGGG + Intronic
959498547 3:107078936-107078958 TGGGGTGTGGGGAGTGGGGAGGG - Intergenic
959499798 3:107093001-107093023 CAGAGTTTGGTGAGAGTGGAAGG + Intergenic
960122179 3:113958084-113958106 CAGCGTGCTGGGTGTGTGGAGGG + Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
961388761 3:126539526-126539548 CGGTGTGTGTGGTGTGTGCATGG - Intronic
961569661 3:127788677-127788699 CAGTGTTGGGGAAGCGTGGAAGG - Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962272764 3:133990200-133990222 CAGTGGTTGGGAAGTGTTGATGG - Intronic
962401341 3:135061738-135061760 TGGTGTGGGGGGAGTGGGGAGGG - Intronic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
962954012 3:140247694-140247716 GAGTGTGAGGGCAGTGTGGGGGG + Intronic
963296713 3:143554693-143554715 CAAGTTGTGGGGAGTGGGGAAGG - Intronic
963340556 3:144027306-144027328 TGGTGTGTAGGGAGTGGGGAGGG + Intronic
963602329 3:147389442-147389464 CAGTGTGTGTGTATTGGGGAGGG - Intronic
963743048 3:149098231-149098253 CAGCTTGTGAGGAGGGTGGAAGG - Intergenic
963904341 3:150762064-150762086 GACTGTGTGGGGATTGAGGAGGG - Intronic
964974127 3:162599677-162599699 CAGCTTGTGGGGAGTGTGGAGGG + Intergenic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966047634 3:175572023-175572045 GATTGTGTGTGGAGTGGGGATGG + Intronic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966794865 3:183703748-183703770 CAGTCTTTGGGAAGAGTGGATGG + Intronic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968039245 3:195574509-195574531 CACTGTGTGGGGAAGGTCGAGGG + Intronic
968194422 3:196694933-196694955 TAGTGTGTGGGGTGTGTAGTGGG - Intronic
968592530 4:1466138-1466160 CAGGGTGTGGGCAGTGGGGCGGG - Intergenic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968866413 4:3215478-3215500 CAGAGTGTGGGAAGTGCGGGGGG - Intronic
968867099 4:3220066-3220088 CAGTGTTGGGGTAGTGAGGAGGG + Intronic
968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG + Intergenic
970085400 4:12340444-12340466 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
970982834 4:22122309-22122331 CTGTGTGTGGAGTGTGTGGGAGG - Intergenic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
974554379 4:63425254-63425276 TGGTGTGGGGGGAGTGGGGAGGG - Intergenic
974905812 4:68055163-68055185 TAGTGTGTGATGAGTCTGGAAGG + Intronic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
975732260 4:77348889-77348911 CAGTGTGTTGGGGGTGGGGGTGG + Intronic
977442706 4:97089550-97089572 GTGTGCGTGGGGGGTGTGGAAGG - Intergenic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
979013487 4:115400904-115400926 CAGTTTCTGGGGAGTGGGGTTGG - Intergenic
979056115 4:115997238-115997260 CAGGGTGTGGGGAGCGGGGAGGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980456831 4:133055007-133055029 CACTGTGGGGGGAGGGGGGAGGG + Intergenic
980864193 4:138535541-138535563 AAATGTGTGGGGAGTGGGGAGGG + Intergenic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
981376921 4:144026715-144026737 TGGTGTGGGGGGAGTGGGGAGGG - Intergenic
981635089 4:146868222-146868244 TGGGGTGTGGGGAGTGGGGAGGG + Intronic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
982549174 4:156775867-156775889 CACTGTGTGTGGGGTGTGGTGGG - Intronic
983929410 4:173436563-173436585 CAGTGTTTGGTGAATGTTGATGG - Intergenic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984694500 4:182766108-182766130 CAGGGTGTGGGGTCTGTGTACGG + Intronic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985072385 4:186180520-186180542 TAGGGTGTGGGGAGAGGGGAGGG - Intergenic
985113883 4:186572543-186572565 CAGGGTGTGGGGTGTGATGAAGG - Intergenic
985174400 4:187186085-187186107 CTGTGTGTGGGTAGTGGTGATGG - Intergenic
985403639 4:189615598-189615620 CAGCTTGCGGGAAGTGTGGAGGG - Intergenic
985646555 5:1087515-1087537 CAGTGCGTGTGGCATGTGGAAGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986806289 5:11311694-11311716 GAGTGTGTGGTGAGGGTGCATGG - Intronic
987067617 5:14304745-14304767 GTGTGTGTGGGGAGTGGGGTGGG + Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
988378978 5:30477037-30477059 AACTGTGAGGGCAGTGTGGAAGG - Intergenic
988404974 5:30812471-30812493 CTGTGTCTTGGGAGTGAGGATGG + Intergenic
988993882 5:36696096-36696118 CAGTGTGGGGTGATTTTGGAAGG - Intergenic
988996000 5:36715432-36715454 CAGTGTGTGGGGTGTGTGCGTGG - Intergenic
989754249 5:44933854-44933876 CAAAGTGTGGAAAGTGTGGAGGG - Intergenic
990168131 5:53017836-53017858 CAGTGTTGGGGGGATGTGGAGGG + Intronic
992157652 5:73970941-73970963 CAGGGAGTGGGGAGGGAGGAAGG + Intergenic
993457382 5:88141758-88141780 CTGTGTGTGGGGGGTGGGGGCGG - Intergenic
994302198 5:98159389-98159411 CAGTGGGTGGGGAGAAGGGAAGG + Intergenic
995081345 5:108054111-108054133 CGGGGTGTGGGGAGAGGGGAGGG + Intronic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
995966142 5:117910201-117910223 TAGTTTGTGGGGAGTGGGGAGGG + Intergenic
996354704 5:122582715-122582737 CAGTGTTTGGGCACTGTGGTAGG - Intergenic
996683794 5:126257532-126257554 AAGTGGGTGGGCAGTGTGTATGG - Intergenic
997038342 5:130220813-130220835 CATCTTGTGGGGAGTATGGAGGG - Intergenic
997368408 5:133340324-133340346 GTGAGTGTGGGGTGTGTGGAAGG + Intronic
997875519 5:137543265-137543287 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
998011464 5:138698812-138698834 AAGAGGGTGGGGAGCGTGGAGGG + Intronic
999230558 5:150059461-150059483 CCGTGTTCTGGGAGTGTGGAGGG - Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999571171 5:152921298-152921320 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1000276978 5:159746582-159746604 AAGTGTCTTGGGAGTGGGGAAGG + Intergenic
1001156397 5:169276003-169276025 CAGTGTGTGGGCTGTGGGGTAGG + Intronic
1001336186 5:170798937-170798959 AAGGGTGTGGGGAGGGGGGAGGG - Intronic
1001445494 5:171779595-171779617 GAGTGGGTGGGGACTATGGAAGG - Intergenic
1001758006 5:174185697-174185719 CAGGGTGTGGGGTGTGTGGGGGG + Intronic
1001845584 5:174918091-174918113 CAGGGTGTGTGGGGTGGGGAGGG + Intergenic
1002345960 5:178547655-178547677 GGGTGTGTGGGGGGTGTGTATGG - Intronic
1002466063 5:179409349-179409371 GTGTGTCTGGGCAGTGTGGATGG - Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002467258 5:179413838-179413860 CAGAGTGTGGGGAGCGGGCAGGG - Intergenic
1002600382 5:180351407-180351429 CAGGGTGGGGGAAGTGGGGAGGG - Intronic
1002922866 6:1585575-1585597 CAGAATGTGGGGAGAGTGGGGGG - Intergenic
1003020533 6:2505220-2505242 CAGTGACGGGGGAGTGAGGAGGG - Intergenic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005426428 6:25707457-25707479 CAGTGGTTGGGGGGTGAGGAGGG + Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1006101827 6:31690299-31690321 GATTGTGTGGGGTGTGTGGTGGG + Intronic
1006255784 6:32830862-32830884 GAGTGTGTGAGGAGTTGGGAGGG - Intronic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006459091 6:34147986-34148008 CAGGGGGTGGGGAGAGTGGCTGG - Intronic
1007397419 6:41585653-41585675 CAGTGTGGGGGAAATGGGGATGG + Intronic
1008139318 6:47813615-47813637 CAGTCTGGTGGCAGTGTGGAAGG + Intronic
1008371182 6:50732651-50732673 TAGTGTGTGGGGACCCTGGAAGG + Intronic
1008862753 6:56169751-56169773 AAGTGTTAGTGGAGTGTGGATGG - Intronic
1009340647 6:62550721-62550743 TAGGGTGCGGGGAGTGGGGAGGG - Intergenic
1009635482 6:66259656-66259678 CAGAGAGTGGGAAGTGTGCAAGG + Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1010898921 6:81401519-81401541 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011718744 6:90133682-90133704 TGGGGTGTGGGGAGGGTGGAGGG - Intronic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1013075000 6:106763449-106763471 CAGTATGTGGGGAGATGGGAGGG + Intergenic
1014696331 6:124626084-124626106 TGGGGTGTGGGGAGTGGGGAGGG - Intronic
1014813152 6:125907393-125907415 CTGTGTTTGGGGAGTGTGAAGGG - Intronic
1014863437 6:126498087-126498109 CACTGTCTGGGAAGTGAGGAGGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016326854 6:142912773-142912795 CATGGTGTGGGGATGGTGGATGG - Intronic
1017172776 6:151473383-151473405 CAGGATGGGGGGAGTGTTGACGG - Intergenic
1017689420 6:156948409-156948431 CAGTGGGTGGTGGGGGTGGAGGG + Intronic
1018749953 6:166795744-166795766 CAGTGTGTGGGCACCGTGGTGGG + Intronic
1018785809 6:167107039-167107061 TAATGTGTGGGGATGGTGGAGGG + Intergenic
1018916715 6:168136722-168136744 CAGAGTGTGGGGAGGGTTGTAGG + Intergenic
1019009085 6:168826686-168826708 CAGTGTTTGGGGACATTGGAAGG + Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1020834113 7:13127135-13127157 CAGTCTGTGGGTTGGGTGGAGGG + Intergenic
1021019086 7:15573987-15574009 CAGTGGGTGGGGCGTGGGGACGG + Intergenic
1021738956 7:23666095-23666117 CAGGGTTTGGGGAGAGTGGGTGG + Intergenic
1021785440 7:24146816-24146838 TGGGGTGTGGGGAGTGAGGATGG + Intergenic
1021968463 7:25945076-25945098 CAGGGTGTGGGCAGGGTTGAGGG - Intergenic
1022602719 7:31776984-31777006 CAGTTTGTGGGGTGGGGGGAGGG + Intronic
1022755484 7:33283794-33283816 GATTGTGTGGGGAGTTTTGAGGG + Intronic
1023141786 7:37109474-37109496 CAGCGCGTGGGGTGTGTGGAAGG - Intronic
1023441277 7:40187285-40187307 TGGGGTGTGGGGAGTGGGGAGGG + Intronic
1023609827 7:41961508-41961530 CAATGTGTGAGGAGTTGGGAGGG + Exonic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1023980925 7:45069572-45069594 AAGTGTGAGGGGACTGTGCAGGG - Intronic
1024056946 7:45666276-45666298 TGGTGTGGGGGGAGTGGGGAGGG - Intronic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1024673314 7:51616177-51616199 CGGTGTGGTGGGAGTGTGAAAGG + Intergenic
1024748243 7:52431620-52431642 CTGCTTGTGGGAAGTGTGGAGGG - Intergenic
1024895229 7:54252431-54252453 CAATGTGTGGGGCGGGTGGAGGG + Intergenic
1025027988 7:55533874-55533896 CAGTGTGTGGTGGGTGGGTAGGG + Intronic
1025681365 7:63684142-63684164 CTGGGTGTGCGCAGTGTGGATGG - Intergenic
1025724241 7:64043168-64043190 CAGTATGAAGGGAGTGGGGAGGG - Intronic
1026907470 7:74070793-74070815 CTGTTCGTGGGGAGTGTGGGTGG + Intergenic
1027266775 7:76498904-76498926 GAGTGTGTGTGGAGTGTGTGTGG + Intronic
1027318189 7:76997150-76997172 AAGTGTGTGGGGTGTGAGGTGGG + Intergenic
1027557385 7:79682792-79682814 GTGTGTGTGTGGTGTGTGGAAGG + Intergenic
1027655894 7:80930436-80930458 GAGTGTGGGGGGAGGGTGGTGGG - Intergenic
1028528310 7:91809893-91809915 CAGTATGTGGGGAATTTTGAAGG + Intronic
1028826777 7:95282596-95282618 CAGCCTCTGGGGAGGGTGGAGGG - Intronic
1029330441 7:99849234-99849256 TAGTTTGTGTTGAGTGTGGATGG - Intronic
1030301340 7:107977286-107977308 CACTGTTTGTGGAGTGGGGAGGG + Intronic
1030363156 7:108616446-108616468 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
1030641052 7:112006894-112006916 CAGTGTGTGGAGAGTTGGGTTGG - Intronic
1030789549 7:113707002-113707024 CACTGTGTGGGGTGTGGGGTGGG - Intergenic
1031840953 7:126738687-126738709 CAGTGTGGGGGGTGAGTGGGGGG + Intronic
1031866564 7:127043614-127043636 TAGGGTGTGGGGAGCGGGGAGGG + Intronic
1032707369 7:134432902-134432924 CGGGGAGTGGCGAGTGTGGATGG + Intergenic
1032885980 7:136138786-136138808 CATTGTGCTGGGAGTGTGGATGG + Intergenic
1032900134 7:136297768-136297790 CATTGACTGGGGAGTCTGGAAGG + Intergenic
1033038368 7:137895992-137896014 CAGTGTTTGGGCAGTGTGCAGGG - Intronic
1033397618 7:140990851-140990873 TAGTGTGAGGGGACTGTGGCAGG + Intergenic
1033437484 7:141346605-141346627 CAGTGTGTGTGGAGTGTGTATGG - Intronic
1033641063 7:143263611-143263633 CAGTGTCTGGGGAGTGAGGGCGG + Intronic
1034347886 7:150398144-150398166 GTGTGTGTGGGGAGTGGGGGTGG + Exonic
1034553321 7:151834714-151834736 CGGAGTGGAGGGAGTGTGGAGGG + Intronic
1034924384 7:155109649-155109671 CTGTGTGTGAGGAATGTGCAGGG + Intergenic
1035053732 7:156019872-156019894 CAGTGTGTTGGGGCTGTGGCTGG + Intergenic
1035447921 7:158955720-158955742 CAGCGTGTGGGGAGTGCTGTGGG - Intronic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036608348 8:10328244-10328266 CAATGAGTGGGGAGGGGGGAGGG - Intronic
1036690992 8:10944707-10944729 CAGGGTGTGTGCAGGGTGGAGGG - Intronic
1037043025 8:14260947-14260969 TGGGGTGTGGGGAGTGGGGAGGG + Intronic
1037822367 8:22141219-22141241 CAGTGTGTGTGGCGTGCGGCAGG + Intronic
1038533824 8:28339590-28339612 GTGTGTGTGTGGAGTGGGGAGGG - Intronic
1038589405 8:28822859-28822881 GAGTGTGTGGGAAGTGTGTGGGG - Intronic
1038939101 8:32284311-32284333 CAGAGTGTGGGGTCAGTGGATGG - Intronic
1039361694 8:36883980-36884002 CAGTGTGTTGGGTGTGGGGTTGG + Intronic
1039451294 8:37676847-37676869 CACTAAGTGGGGAGTGGGGATGG + Intergenic
1039464827 8:37777426-37777448 CAGTGGTTGGAGAGTGTGGCTGG - Intronic
1039610904 8:38918615-38918637 CTGTGTGTGGTGTGTGTGTATGG - Intronic
1039643046 8:39244700-39244722 TGGGGTGTGGGGAGTGGGGAGGG + Intronic
1040102282 8:43516389-43516411 TAGGGTGGTGGGAGTGTGGAGGG + Intergenic
1040550579 8:48434274-48434296 CAGTGTGTGGGGTGTGGGGACGG + Intergenic
1040983126 8:53266260-53266282 ATGGGTGTGGGGAGTGGGGAAGG - Intergenic
1041090656 8:54298052-54298074 CAGTGGGTGGGAGGTGGGGAGGG + Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041620855 8:59967206-59967228 GAGTGTGGGGTGAGTGTGCATGG - Intergenic
1041706608 8:60852988-60853010 CAGAGTGGTGGGAGTGTGGACGG + Exonic
1041727743 8:61033547-61033569 CAGTCAGGGGGGAGTGTGGGTGG + Intergenic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1043318244 8:78948110-78948132 AATTGTGTGGGGTGTGTGGGGGG - Intergenic
1044294697 8:90513875-90513897 CAGAGTGTGGGGTGGGAGGAGGG + Intergenic
1044928660 8:97231197-97231219 CAGTGGCTGGGGAGTCTTGAGGG + Intergenic
1044968785 8:97599620-97599642 CATAGTGTTGGGAGTGTGGTGGG + Intergenic
1045065047 8:98437046-98437068 CTGTGTGTGAGGGGAGTGGAGGG - Intronic
1045097460 8:98812886-98812908 TAGGGTGGGGGGAGTGAGGAGGG + Intronic
1045152914 8:99429130-99429152 TGGGGTGTGGGGAGTGGGGAGGG + Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046240562 8:111485308-111485330 TGGGGTGGGGGGAGTGTGGAGGG + Intergenic
1046597029 8:116272974-116272996 CAGTGAGTGGTGAATGTGGGTGG + Intergenic
1046732459 8:117740075-117740097 AAGTGTGTGGTAAGTTTGGAGGG - Intergenic
1047563814 8:126018755-126018777 CAGTGTGTGGAGAGTGGGAAGGG - Intergenic
1047955547 8:129972709-129972731 ATGTGTGTGGGGTGTGTGCATGG - Intronic
1048018365 8:130517338-130517360 TTGTGAGTGGGGTGTGTGGAGGG + Intergenic
1049130420 8:140835078-140835100 CAGTGAGTGGGGAATGCTGATGG - Intronic
1049161593 8:141101684-141101706 CAGTGGGAGGGCAGTGGGGAAGG - Intergenic
1049812787 8:144582971-144582993 CAGAGTCTGGGGCCTGTGGAGGG - Intronic
1050420457 9:5459015-5459037 CAGCCTGTAGGGAGTGTGTAGGG + Intronic
1050783434 9:9368902-9368924 TGGGGTGTGGGGAGTGGGGAGGG - Intronic
1051604798 9:18908649-18908671 GGGTGTGTGTGGAGTGGGGAGGG - Exonic
1051695225 9:19760913-19760935 CCGGGTGGGGGGAGGGTGGAGGG + Intronic
1051706165 9:19882494-19882516 AAGTGGGTGGGGGGCGTGGAGGG - Intergenic
1053529964 9:38870760-38870782 CAGAGTGTGGTGACTGTGGGAGG + Intergenic
1053700605 9:40686073-40686095 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1053748493 9:41229385-41229407 CAGTGTGTGTGGTGTCTGGGTGG + Intergenic
1054202189 9:62095187-62095209 CAGAGTGTGGTGACTGTGGGAGG + Intergenic
1054311897 9:63485471-63485493 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054337843 9:63823456-63823478 GTGTGTGTGGGGAGTATGTATGG - Intergenic
1054337850 9:63823487-63823509 CAGTGTGTGGGGAGTATGTGTGG - Intergenic
1054410671 9:64809528-64809550 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054636168 9:67493173-67493195 CAGAGTGTGGTGACTGTGGGAGG - Intergenic
1054869250 9:70034335-70034357 AGGTGTGTGGGGTGTGTGCATGG - Intergenic
1054902456 9:70383518-70383540 AAATGTGTAGGGAGTGTGGAAGG - Intergenic
1055415559 9:76079074-76079096 GTGTGTGTGGCTAGTGTGGATGG + Intronic
1056139058 9:83656894-83656916 CAGTGTGTGGGGCATGGGGGAGG - Intergenic
1056311248 9:85343136-85343158 AAGTGTGTGTGGAGTGGTGATGG - Intergenic
1056590567 9:87963332-87963354 CAATATGTGGGGGGTGGGGAGGG + Intergenic
1056829386 9:89902594-89902616 CAGTGTGTGGAGTGTGTTGGGGG - Intergenic
1056871858 9:90289405-90289427 CACAGTGTGGGGGGTGTGGTGGG - Intergenic
1056925897 9:90834343-90834365 TCATGAGTGGGGAGTGTGGAGGG - Intronic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057310218 9:93938345-93938367 CAGTGAGTGGGGAGAGGGGGTGG + Intergenic
1057517277 9:95732408-95732430 CTGAGTGTGGGGAGTGGTGAGGG + Intergenic
1057853718 9:98585491-98585513 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
1057906698 9:98988972-98988994 CAGCGTGTGTGCAGTGTGCATGG - Intronic
1058081075 9:100701717-100701739 AATTGGGTGGGGAGTGTGGGGGG - Intergenic
1058680474 9:107436395-107436417 CAGCCTGTGGGAAGTGTGGCTGG - Intergenic
1059249902 9:112879292-112879314 CAGCCTGAGGGGAATGTGGAAGG - Exonic
1059331331 9:113537489-113537511 CAGTGCCTGGGGAGAGGGGATGG + Intronic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1060280510 9:122213005-122213027 CAGTGTGATGGGAGTGTCCAGGG - Intronic
1060406476 9:123375486-123375508 TCTTGTGTGGGGGGTGTGGAAGG - Intronic
1061061840 9:128254393-128254415 CAGCGTGTGTGGGGTGGGGAGGG + Intronic
1061203579 9:129150656-129150678 CACTGTGGTGGGAGTGGGGACGG + Intergenic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062134055 9:134915375-134915397 CAGTGGCTGGGGAGAGTGTATGG + Intronic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1202784682 9_KI270718v1_random:37767-37789 CAGTGTGTGGGGAGTAGGTGTGG + Intergenic
1202784689 9_KI270718v1_random:37796-37818 TGGTGTGTGGGGAGTATGTATGG + Intergenic
1185907013 X:3944354-3944376 GTGTGTGTGGGGAGTGCGGTGGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1188364816 X:29302735-29302757 CAGTGTGTGGGGATGTTGAATGG + Intronic
1188482248 X:30647959-30647981 CAGGGTAGGGCGAGTGTGGAAGG + Intergenic
1188506714 X:30891130-30891152 CAGTATGTGGGGTGTGTGATAGG - Intronic
1189261033 X:39678997-39679019 CAGTGTATGGGGCGGGTGGGGGG - Intergenic
1189709014 X:43789927-43789949 GATTGGGTGGGGGGTGTGGAGGG + Intronic
1189779974 X:44504968-44504990 CAGTGTGTGCGGGGTGGGGGCGG - Intergenic
1190157337 X:48004611-48004633 CAGTGTGTTGGGAGTGTAGGGGG + Intronic
1190173107 X:48127496-48127518 CAGTGTGTTGGGAGTGTAGGGGG + Intergenic
1191649885 X:63525115-63525137 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1191798674 X:65053248-65053270 CGGGGTGGGGGGAGTGGGGACGG - Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1192029537 X:67494347-67494369 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193584323 X:83301739-83301761 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1193778356 X:85671849-85671871 CAGAGTGGGGGAAGTGAGGATGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194026995 X:88764661-88764683 CAGTGTATGGGGAGTGGGAGAGG - Intergenic
1194815673 X:98438545-98438567 CAGAGAGTGGGGGGTGGGGAAGG + Intergenic
1194876223 X:99191653-99191675 CAGGCTGTGGGGGATGTGGAAGG - Intergenic
1195066393 X:101241977-101241999 CAGTGTCTGGGGAGAGTGTCAGG - Intronic
1195086084 X:101415954-101415976 CAGTGTTTGGGGGGTGTTGTGGG - Intergenic
1195468567 X:105208902-105208924 CTGTGTGTGGACAGTGTGCATGG - Intronic
1195824825 X:108988382-108988404 TGGGGTGTGGGGAGTGGGGAGGG - Intergenic
1196049346 X:111288848-111288870 CAGGGGGTGGGGAGTGGGTAAGG - Intergenic
1196118768 X:112025825-112025847 CAGTGGATGGGGAGTGAGAAAGG - Intronic
1197433210 X:126391991-126392013 CAGGGTGTGGGGTGGGGGGAGGG + Intergenic
1197466004 X:126805189-126805211 TGGGGTGTGGGGAGTGGGGAGGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198044862 X:132891526-132891548 TGGGGTGGGGGGAGTGTGGAGGG - Intronic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198344377 X:135745113-135745135 TGGTGTGTGGGGAGCGGGGAGGG + Intergenic
1198404552 X:136299531-136299553 TGGGGTGGGGGGAGTGTGGAGGG + Intergenic
1198404704 X:136300727-136300749 TGGGGTGGGGGGAGTGTGGAGGG - Intergenic
1198646386 X:138811445-138811467 TGGGGTGGGGGGAGTGTGGAGGG + Intronic
1198791319 X:140349931-140349953 CAGAGTGTGAGGAGAGTGGTAGG - Intergenic
1199849549 X:151715623-151715645 CCGTGTCTGGGGACTCTGGATGG + Intergenic
1200090653 X:153634357-153634379 CAGTGGGTGGGGAGTGGGTCAGG - Intergenic
1200092094 X:153640753-153640775 CAGTGGAGGGGGAGTGTGAAAGG + Intergenic
1200860761 Y:7989266-7989288 CTGTGTGTGTGTAGTGGGGATGG - Intergenic
1201069487 Y:10132195-10132217 TGGGGTGTGGGGAGTGGGGAGGG - Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201787760 Y:17804462-17804484 CGGGGTGCGGGGAGTGGGGAGGG - Intergenic
1201813793 Y:18101526-18101548 CGGGGTGCGGGGAGTGGGGAGGG + Intergenic
1202104660 Y:21350611-21350633 TAGTGTGTGGGGATGGGGGAGGG - Intergenic
1202367933 Y:24179604-24179626 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1202391504 Y:24375052-24375074 GGGTGTGTGTGGAGTGTAGAGGG - Intergenic
1202479281 Y:25295065-25295087 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
1202502850 Y:25490513-25490535 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic