ID: 1113941659

View in Genome Browser
Species Human (GRCh38)
Location 13:114021572-114021594
Sequence AGGCCACGCTTTGTTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113941656_1113941659 -2 Left 1113941656 13:114021551-114021573 CCCGTGTGGAGCAAAGATGACAG 0: 1
1: 1
2: 0
3: 20
4: 187
Right 1113941659 13:114021572-114021594 AGGCCACGCTTTGTTCCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 133
1113941657_1113941659 -3 Left 1113941657 13:114021552-114021574 CCGTGTGGAGCAAAGATGACAGG 0: 1
1: 0
2: 3
3: 17
4: 206
Right 1113941659 13:114021572-114021594 AGGCCACGCTTTGTTCCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113941659 Original CRISPR AGGCCACGCTTTGTTCCCCC AGG Intronic
900033121 1:385562-385584 AGGCTGCGCTTTGTTCCCGAAGG - Intergenic
900413341 1:2523692-2523714 AGGTCCCGTTTTGTCCCCCCGGG - Intronic
901865988 1:12107023-12107045 AGGCCTCCCTTTGCTGCCCCTGG + Intronic
909618694 1:77643017-77643039 AGGCCTCACTTTGTTGCCCAGGG - Intronic
909802013 1:79821663-79821685 AGGCCTCACTTTGTTGCCCAGGG - Intergenic
911104339 1:94118163-94118185 AGGCCTCTCTGTGATCCCCCCGG - Intronic
912361635 1:109100482-109100504 CGGCCACGCTGTGGTCCCCGAGG + Intergenic
916496485 1:165352750-165352772 AGGCCACTCTTTGTTAGCCTTGG - Intronic
920242002 1:204559509-204559531 GGGTCTCGCTTTGTCCCCCCAGG + Intergenic
922255481 1:223889713-223889735 AGGCTGCGCTTTGTTCCCGAAGG - Intergenic
924336684 1:242992582-242992604 AGGCTGCGCTTTGTTCCCGAAGG - Intergenic
1063442354 10:6083200-6083222 ATTCCACGCCTTGCTCCCCCAGG - Intergenic
1064404278 10:15047323-15047345 AGGCCACCCCTTGTGCCACCAGG + Intronic
1069886543 10:71627463-71627485 AGGCCACCCTCTGGTCCCCAGGG - Intronic
1070725539 10:78785473-78785495 AGGCCACGATTTGTTCCACTAGG + Intergenic
1072034274 10:91550180-91550202 AGGCCACGCTTCATTTCTCCAGG - Intergenic
1074823475 10:117198351-117198373 AGGCAAAGCTTTGTTCTCTCTGG + Intronic
1075192688 10:120325354-120325376 AGGCAATGCTTTGTGCTCCCTGG + Intergenic
1075626307 10:123966606-123966628 AGGCCAGGGTTTGCTCCCCCAGG - Intergenic
1079564681 11:21866880-21866902 AGGCCTTGCTTTGTTTGCCCAGG + Intergenic
1083643250 11:64157021-64157043 AGGCCCCTCTTTGTTCCCCCTGG + Intronic
1084597833 11:70127668-70127690 GGGCCCCACTCTGTTCCCCCAGG - Intronic
1093121736 12:15279175-15279197 TTGCCTCGCTTTGTTCCCCATGG - Intronic
1093413689 12:18896084-18896106 AGGCCATGCTTTTTTCCGGCTGG - Intergenic
1104031376 12:125067557-125067579 AAGCCTCGCTTTTCTCCCCCAGG + Intronic
1107658919 13:42619195-42619217 TGGCCAACCTTTGTTCTCCCTGG - Intergenic
1107710310 13:43144794-43144816 ATCCCACTTTTTGTTCCCCCTGG - Intergenic
1108764665 13:53612195-53612217 AGCACAAGCTTTGTTCCCACTGG + Intergenic
1113941659 13:114021572-114021594 AGGCCACGCTTTGTTCCCCCAGG + Intronic
1120435865 14:84481418-84481440 AGGCAATGGTTTGTTCCTCCTGG + Intergenic
1121994637 14:98592828-98592850 CGCCCCCGCTCTGTTCCCCCAGG - Intergenic
1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG + Exonic
1126619012 15:50617848-50617870 AGGTCTCGCTTTGTTTGCCCAGG + Intronic
1128328361 15:66739830-66739852 GGGCCTCGCTTTGTTGCCCAGGG + Intronic
1129973025 15:79796962-79796984 AGGCCACTCTCTATGCCCCCAGG + Intergenic
1130276208 15:82477528-82477550 AGCACACCCTTTGTTCCTCCTGG + Intergenic
1130468567 15:84204921-84204943 AGCACACCCTTTGTTCCTCCTGG + Intergenic
1130590860 15:85209520-85209542 AGCACACCCTTTGTTCCTCCTGG + Intergenic
1130691823 15:86088169-86088191 AGGCCATAGTTTGTTACCCCTGG + Intergenic
1131122898 15:89834102-89834124 TGGGCACGCTCTGTTCCCTCAGG - Exonic
1133142223 16:3754369-3754391 AGTCCACACTTTATTCTCCCTGG + Intronic
1135634878 16:24067041-24067063 AGGTCTCGCTGTGTTGCCCCAGG + Intronic
1135681360 16:24460093-24460115 AGGCCACCCTGTATTCACCCAGG + Intergenic
1136228041 16:28872114-28872136 AGGCAAGGCTTTTTTCTCCCAGG + Intronic
1136542729 16:30937355-30937377 AGGTCAGGCATTGTCCCCCCAGG + Intronic
1137005579 16:35272143-35272165 AGGCCCAGCTTTGTCTCCCCAGG - Intergenic
1137675497 16:50301905-50301927 AGGCCAGCCCTTGGTCCCCCAGG - Intronic
1138448902 16:57081319-57081341 CTGCCAGGCTTAGTTCCCCCTGG + Intronic
1140374505 16:74434055-74434077 AGGCCATGCTTTCCTCCTCCAGG + Intergenic
1141144402 16:81518804-81518826 AGGTCTCGCTATGTTGCCCCAGG - Intronic
1142611303 17:1110208-1110230 AGGCCACATTCTGGTCCCCCTGG + Intronic
1142803364 17:2358901-2358923 AAGTCTCGCTGTGTTCCCCCAGG + Intronic
1144258185 17:13490698-13490720 AGGCCACACGTTGCTGCCCCTGG + Intergenic
1146794377 17:35770856-35770878 AGGTCTTGCTTTGTTTCCCCAGG - Intronic
1147610084 17:41796672-41796694 GGGCCACTCTTTGTTCCCAAGGG + Intergenic
1148615809 17:48998603-48998625 AGGCCCCGCTCCGCTCCCCCAGG + Intronic
1156220625 18:35047949-35047971 AGGCCTCTCTTTGTTCCAGCAGG + Intronic
1156664567 18:39390057-39390079 AGGCCACCCTTTTTTCCTACTGG + Intergenic
1158946990 18:62455657-62455679 TGGCAACGCTTTCTTCTCCCTGG + Intergenic
1160286838 18:77550897-77550919 AGGCCACTCTTTGTCTCCCAAGG + Intergenic
1160921893 19:1524495-1524517 ATGCGACGCTGTGTTGCCCCTGG + Intronic
1161036575 19:2088245-2088267 AGGACAAGCTTTGTCCCCCTCGG - Intronic
1161285195 19:3464836-3464858 GGCCCACGCTTTGATCCCCAAGG - Intronic
1163275818 19:16283620-16283642 GGGCCAGGTTTTTTTCCCCCCGG + Intergenic
1166252973 19:41584284-41584306 AGGCCCCTCATGGTTCCCCCTGG + Intronic
1166411148 19:42555967-42555989 AGGCCCCTCATGGTTCCCCCTGG - Intronic
926750917 2:16197817-16197839 AGGGCAGGCTTTGTCCCTCCTGG + Intergenic
926787460 2:16532098-16532120 AGGCCACCCTCTGTTCCCAGAGG - Intergenic
927250620 2:20992200-20992222 AGGCCTGGGTTTGTTCTCCCCGG + Intergenic
931039740 2:58284066-58284088 AGGCCTTGCTAAGTTCCCCCTGG - Intergenic
933173959 2:79156281-79156303 AGGCCAGGCTCTGTGGCCCCAGG - Intergenic
933686856 2:85148357-85148379 AGGCCACCCCTTGTCCCTCCAGG + Intronic
933969563 2:87459213-87459235 AGGCCATGTTATGTTCACCCTGG - Intergenic
934043319 2:88147836-88147858 AGGCCAATCTTTGGGCCCCCAGG - Intergenic
934904515 2:98187089-98187111 TGGCCACACTCTGTTCCGCCAGG + Intronic
936324224 2:111491284-111491306 AGGCCATGTTATGTTCACCCTGG + Intergenic
937086229 2:119173750-119173772 TGGCCACGTCTTGTTCACCCTGG - Intergenic
938271974 2:129980169-129980191 TTGCAACGCTTTGCTCCCCCAGG - Exonic
938444034 2:131363645-131363667 TTGCAACGCTTTGCTCCCCCAGG + Intergenic
940356310 2:152746847-152746869 AGGTCTTGCTTTGTTGCCCCAGG + Intronic
1172113358 20:32560186-32560208 AGGCCACGATTGGTGCCCACTGG - Intronic
1178611673 21:34087652-34087674 AGGCAACACTTTGTAACCCCAGG - Intronic
1180260201 21:46663226-46663248 AAGCCAAGCTTTGTGTCCCCAGG + Intronic
1181131016 22:20732352-20732374 AGGCCATGCCCTGTTCTCCCAGG - Intronic
1183406443 22:37632786-37632808 AGGACACCCTTTGTTGCCCATGG + Exonic
1183729707 22:39611095-39611117 AGGCCAGGCCTTGTTACTCCTGG + Intronic
1183790136 22:40060753-40060775 AGGACACACTTAATTCCCCCAGG + Intronic
1184687039 22:46100912-46100934 AGGTCACACTGTGGTCCCCCGGG - Intronic
1185343886 22:50303095-50303117 AGGCCTCCCTTGCTTCCCCCAGG + Intronic
952633995 3:35505390-35505412 AGGCCACGCTTTTTCCCTGCTGG + Intergenic
954326870 3:49868762-49868784 AGTCCAGGCTTTGAGCCCCCAGG - Intronic
954658201 3:52210580-52210602 AGGCCATGCTTCGTTGCCCAGGG - Intronic
969216150 4:5723946-5723968 AGGCCAGGCTCTGTACCCTCAGG + Intronic
976235321 4:82890909-82890931 ATGCCAGGCGTTGTTCCGCCGGG + Intronic
976757767 4:88516571-88516593 AGGCCAGGTTTTGCTCCCTCAGG + Intergenic
979240444 4:118442727-118442749 AGGCTGCGCTTTGTTCCCGAAGG + Intergenic
980945225 4:139313172-139313194 AGGCCAGGCTTTTTTTCCCTAGG - Intronic
987455486 5:18139616-18139638 AAGCCACACTTTTTTCCCCAAGG + Intergenic
988994103 5:36697900-36697922 AGACCCCTCTTTGTTCCCCTTGG + Intergenic
989578385 5:43009981-43010003 AGACCTTGCTTTGTTCCCCCTGG + Intergenic
994002615 5:94798296-94798318 CTGCCAAGCTTTGTTCCCCTTGG - Intronic
1002740699 5:181433306-181433328 AGGCTGCGCTTTGTTCCCGAAGG + Intergenic
1005979972 6:30829256-30829278 TGGCCACACTCTGTTCCCCCAGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007618919 6:43199674-43199696 AGGCCAAGCTATGTTAACCCTGG - Intronic
1009742025 6:67758492-67758514 AGGCCAGCCTTGGTTTCCCCAGG + Intergenic
1013536387 6:111066713-111066735 GGGCCACACTGTGTTCCACCAGG + Intergenic
1016621404 6:146113183-146113205 ATGCCATGATCTGTTCCCCCAGG - Intronic
1016972433 6:149776602-149776624 GGGCCTCACTTTGTTACCCCAGG + Intronic
1017999244 6:159564337-159564359 GGGCCAAGCTTCCTTCCCCCTGG + Intergenic
1019935809 7:4256848-4256870 AGGCCATCCTTTTATCCCCCAGG + Intronic
1022185210 7:27960714-27960736 AAACCAGGCTTTGTTCCTCCAGG - Intronic
1024537579 7:50450659-50450681 GAGCCACGCTTTGCTCTCCCAGG - Intronic
1029224001 7:99011918-99011940 AGGCCAGGCTGTGTGCCCTCAGG - Intronic
1035502315 8:99296-99318 AGGCTGCGCTTTGTTCCCGAAGG - Intergenic
1037903107 8:22699557-22699579 AGGTCTCGCTTTGTTGCCCAGGG - Intergenic
1044930075 8:97244083-97244105 ATGCCACTCTTTTCTCCCCCAGG + Intergenic
1049531671 8:143158485-143158507 AGGCCACGCTTTCTCTTCCCAGG - Exonic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1052337430 9:27334847-27334869 GAGTCTCGCTTTGTTCCCCCAGG + Intronic
1054452732 9:65412062-65412084 TGGCAACGACTTGTTCCCCCAGG - Intergenic
1056007198 9:82285275-82285297 AGGACTCCCTTTGTTGCCCCAGG - Intergenic
1058872794 9:109216959-109216981 AGGCCCCTCTTTGTTCTCCAGGG + Exonic
1060914584 9:127379109-127379131 AAGCCTCCCTTTGTTCCCTCAGG - Intronic
1061925293 9:133803211-133803233 AGGCCACGCCCTCCTCCCCCAGG - Intronic
1062111808 9:134785973-134785995 ATGCAACTCTTTCTTCCCCCAGG + Exonic
1203606007 Un_KI270748v1:58113-58135 AGGCTGCGCTTTGTTCCCGAAGG + Intergenic
1194090711 X:89579999-89580021 AGACCCCTCTTTGCTCCCCCAGG - Intergenic
1194488852 X:94521946-94521968 AAGCCACACTTTGTTCTCCGTGG - Intergenic
1195241693 X:102959316-102959338 AGGCCAGTCTGTGTTCCCCATGG - Intergenic
1197238998 X:124103331-124103353 AGGCCACGTTCTGGTACCCCTGG - Intronic
1197336545 X:125216055-125216077 AGGTCTCCCTATGTTCCCCCAGG - Intergenic
1199909508 X:152270985-152271007 AAGCCTCGCTTTTGTCCCCCAGG + Intronic
1200443363 Y:3236059-3236081 AGACCCCTCTTTGCTCCCCCAGG - Intergenic
1202151933 Y:21851419-21851441 AGGCCACGCATGGCTCCCCATGG + Intergenic
1202372929 Y:24210449-24210471 AGCACACGCTTTGCTCCTCCTGG + Intergenic
1202388173 Y:24344550-24344572 AGGCTGCGCTTTGTTCCCGAAGG + Intergenic
1202482614 Y:25325578-25325600 AGGCTGCGCTTTGTTCCCGAAGG - Intergenic
1202497853 Y:25459671-25459693 AGCACACGCTTTGCTCCTCCTGG - Intergenic