ID: 1113941974

View in Genome Browser
Species Human (GRCh38)
Location 13:114023154-114023176
Sequence GAGGGTGACCAGGGATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 231}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113941963_1113941974 3 Left 1113941963 13:114023128-114023150 CCAGGGCAGTGTTAGCCCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 218
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941960_1113941974 5 Left 1113941960 13:114023126-114023148 CCCCAGGGCAGTGTTAGCCCCTG 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941953_1113941974 27 Left 1113941953 13:114023104-114023126 CCACGTGTCCCATTAAGGGTCCC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941958_1113941974 7 Left 1113941958 13:114023124-114023146 CCCCCCAGGGCAGTGTTAGCCCC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941959_1113941974 6 Left 1113941959 13:114023125-114023147 CCCCCAGGGCAGTGTTAGCCCCT 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941957_1113941974 18 Left 1113941957 13:114023113-114023135 CCATTAAGGGTCCCCCCAGGGCA 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941956_1113941974 19 Left 1113941956 13:114023112-114023134 CCCATTAAGGGTCCCCCCAGGGC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231
1113941961_1113941974 4 Left 1113941961 13:114023127-114023149 CCCAGGGCAGTGTTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 214
Right 1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG 0: 1
1: 0
2: 2
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113941974 Original CRISPR GAGGGTGACCAGGGATTTGA TGG Intronic
901150372 1:7097273-7097295 CAGGGAGGCCAGGGCTTTGATGG + Intronic
902036111 1:13459371-13459393 GAGGGCAAGCAGGGAGTTGATGG - Intergenic
902046025 1:13525150-13525172 ATGGCTGACCAGGGTTTTGAAGG + Intergenic
902976868 1:20094916-20094938 AAGGGTGACCAAGTAGTTGATGG + Intergenic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
904772079 1:32886280-32886302 GAGGGGGACCGGGGAACTGAGGG + Intronic
905226852 1:36484505-36484527 GATGGTGAAAAGGGATTTGGGGG - Intergenic
905673306 1:39807658-39807680 GAGGGAGACGAGGGAGATGAGGG - Intergenic
907389582 1:54149541-54149563 GAAGGTGACCAGGGATGTGCTGG - Intronic
907944303 1:59119961-59119983 GACAGTGACCAGGGAGTTTATGG - Intergenic
907982108 1:59493613-59493635 GATAGTTACCAGGGATTTGGGGG + Intronic
908566270 1:65359572-65359594 AAGGGTCCTCAGGGATTTGAGGG - Intronic
913535880 1:119771698-119771720 GGGAGTGGCCAGGGATTTGGAGG - Intergenic
915585365 1:156841218-156841240 GAGGGTGAGAAGGGATTAAATGG + Intronic
917185756 1:172353215-172353237 GAGAGTGATCTGGGTTTTGATGG - Intronic
920743192 1:208600638-208600660 CAGGGTGACCAGTGCTCTGATGG + Intergenic
923661064 1:235957655-235957677 GAGGGTAAACAAGAATTTGAGGG - Intergenic
923911020 1:238444249-238444271 GAATGTGACCATGGATTTGGTGG - Intergenic
924727593 1:246684694-246684716 GAGGGTCACAGGGGATATGACGG - Intergenic
924947732 1:248857581-248857603 GAGGTTGCCCTGGGGTTTGAGGG - Intronic
1062950138 10:1492812-1492834 GAGGGAGAGCAGGGCTTTGTAGG + Intronic
1063867911 10:10386894-10386916 GAAGGTGACAAGGTATTTTAAGG + Intergenic
1065831590 10:29619303-29619325 GAGGAAAACCAGGGATGTGAAGG + Intronic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1069723024 10:70561630-70561652 GAGGGTTTCTGGGGATTTGAGGG - Intronic
1069898702 10:71694930-71694952 TCGCGTGGCCAGGGATTTGATGG + Intronic
1070389585 10:75957823-75957845 GAGGATGACGAGGGCTTTGATGG + Intronic
1070799925 10:79239350-79239372 GAGAAGGACCAGGGATGTGAAGG + Intronic
1072089512 10:92113669-92113691 GAGGGTGGGCAGTGATGTGAAGG - Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074650805 10:115522583-115522605 GAAGAACACCAGGGATTTGAGGG - Intronic
1074702429 10:116104312-116104334 GAGGCTGAGCAGGGATTTGAGGG - Intronic
1076923356 10:133467012-133467034 GACGGTGGCCAGGGATGGGAGGG + Intergenic
1077473354 11:2775145-2775167 CAGGCTGAGCAGGGGTTTGATGG - Intronic
1077664153 11:4093116-4093138 GAGGGTGTCCAGGGAGTACAAGG - Exonic
1077923208 11:6656181-6656203 GAGGGAGACCAGGGCACTGAGGG - Intergenic
1078160067 11:8832543-8832565 GAAGGTAACCAGGAGTTTGAAGG - Intronic
1083212336 11:61195882-61195904 GAGGGAGAGCAGGGCTGTGAGGG + Intergenic
1083273873 11:61586231-61586253 AAGGGTGGTGAGGGATTTGAGGG - Intergenic
1085852053 11:80132362-80132384 GAGGGTTGCCAGGGCCTTGAGGG - Intergenic
1085885076 11:80512219-80512241 GAGGGTGAGGAGGCATTAGAAGG - Intergenic
1088378683 11:109169684-109169706 GAAAGTGACCAGGGCTTTGGGGG - Intergenic
1090566066 11:127993408-127993430 GAGGGTGGGCAGAGATTTCAAGG + Intergenic
1091194265 11:133718277-133718299 GGGGGTGGGCAGGGATCTGAAGG - Intergenic
1091362328 11:134987467-134987489 GAGGGTCACCAGGGCTGTGAGGG - Intergenic
1094455552 12:30628842-30628864 GAGGGTGACCAGGGCTTATCAGG - Intergenic
1099325755 12:81212919-81212941 GAAGATGAACAGGGAATTGAAGG - Intronic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1100404387 12:94260711-94260733 GGTGCTGACCAGGGACTTGATGG + Exonic
1101208747 12:102514685-102514707 GAGGATGAGCAGGGACTTGGGGG + Intergenic
1101785031 12:107875078-107875100 GAGGTTGACGAGGAATATGATGG - Intergenic
1104189622 12:126467384-126467406 GAAGGGGACATGGGATTTGAGGG + Intergenic
1104781094 12:131421025-131421047 AAGGGTGACCAGGGACCTGGTGG + Intergenic
1109162316 13:58991098-58991120 TAGGGTGACATGGGATTGGATGG - Intergenic
1109213650 13:59563465-59563487 GAGGGTGACCAGAGGAGTGAGGG - Intergenic
1109527215 13:63592265-63592287 GTAAGTGACCCGGGATTTGAAGG - Intergenic
1111460470 13:88535212-88535234 GAAAGTGACCAGGTACTTGAGGG - Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1114253589 14:20982598-20982620 GAGGGTGAGCAAGGGTTTGCTGG - Intergenic
1119420588 14:74505730-74505752 GAAGGTTCCCAGGGATTAGATGG + Intronic
1120690300 14:87585244-87585266 GAAAGTGACAAGGGATTAGAAGG + Intergenic
1121046443 14:90791666-90791688 GAGGGTGAACAGGGACTGGCGGG - Intronic
1124047572 15:26164207-26164229 GGGGGTGACCAGGCTTTGGATGG + Intergenic
1125001114 15:34770785-34770807 GAGGCAGACCAGGGAGCTGATGG - Intergenic
1130144528 15:81263785-81263807 AAGGGTGACCTGTGACTTGAAGG - Intronic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1131352193 15:91711356-91711378 GTGGGTCACAAGAGATTTGAAGG - Intergenic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1131671529 15:94624893-94624915 GAGAGGGACAAGGGAATTGAGGG + Intergenic
1132466749 16:81144-81166 GAGAGTGGCCTGGGATTTCATGG - Intronic
1132953522 16:2578411-2578433 GAGGATGTCCAGGGAGCTGACGG + Intronic
1132960830 16:2621756-2621778 GAGGATGTCCAGGGAGCTGACGG - Intergenic
1133018513 16:2955747-2955769 GAGGGTGGCCAGGACTCTGAGGG + Intergenic
1133503135 16:6384581-6384603 GAGGGTAAACAGGGCTTTGGAGG + Intronic
1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG + Intergenic
1136591946 16:31222972-31222994 GTGTGTGACCAGGCAGTTGATGG + Intronic
1137446421 16:48535186-48535208 GATGGTGACCAGGGTTTGCAGGG + Intergenic
1138378929 16:56587021-56587043 AAGGGTGGCCAGGATTTTGAGGG - Intergenic
1140641607 16:76979975-76979997 GCGGGTGGCCTGGGTTTTGATGG - Intergenic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1141242396 16:82275699-82275721 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242413 16:82275801-82275823 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242430 16:82275903-82275925 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242445 16:82276005-82276027 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242463 16:82276107-82276129 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242478 16:82276209-82276231 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242496 16:82276311-82276333 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242513 16:82276413-82276435 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242528 16:82276515-82276537 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141242546 16:82276617-82276639 GATGTTGACCAGTGATTTGGGGG + Intergenic
1141881089 16:86859924-86859946 GAAGGTGACCATGGACTTCATGG + Intergenic
1143104239 17:4520426-4520448 GGGGGTGACGAGGGACTGGAGGG - Intronic
1143908965 17:10231796-10231818 GATGGGAACCAAGGATTTGAAGG - Intergenic
1147561737 17:41513522-41513544 TGGGGTGACCAGGGAAGTGAGGG - Intergenic
1151674999 17:75592706-75592728 GAGGATGCCCAGGACTTTGAGGG + Intergenic
1151703321 17:75754484-75754506 GTGGGTGACCAGGAATGTGCAGG + Intronic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1154493155 18:14936593-14936615 GAGGGACACCAGGGCTGTGAGGG + Intergenic
1156404294 18:36769889-36769911 TAGGGTAGCAAGGGATTTGATGG + Intronic
1156966698 18:43103070-43103092 TTTGGTGACCATGGATTTGAAGG - Intronic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1161347430 19:3775275-3775297 GAGGGTGTGCAGGGCTTTAAGGG + Intergenic
1162865728 19:13545267-13545289 GATGGTGGCCTGGAATTTGATGG - Intronic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1163837155 19:19581970-19581992 GAGAGTGCCCTGGGATGTGAAGG + Intronic
1164632255 19:29769356-29769378 GAGGGTGCACAGGGAGTTGGTGG - Intergenic
1165393787 19:35552997-35553019 GAGGGAGCCCAGGGATGGGATGG + Intronic
1165995839 19:39843340-39843362 GATGGTGACCAGGGAAGTGCCGG + Intronic
1167210007 19:48128321-48128343 GAGGCTGAGCAGGGAGTTGGTGG - Intronic
1167651993 19:50736698-50736720 GAGGGTGAACAGGCAATTGTGGG + Intergenic
925224034 2:2167093-2167115 GAGGGTAACCAGGGTTTAAAGGG + Intronic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
925998406 2:9310694-9310716 GAGGGTGACCTGTGAACTGAAGG + Intronic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
927957677 2:27219192-27219214 GAGACTGTCCAGGGATCTGAAGG - Intronic
928287724 2:30008154-30008176 GAGGGAGAGGAGGAATTTGAGGG - Intergenic
930639315 2:53839294-53839316 GAGGGGGAAAAGGGAATTGATGG - Intergenic
930957966 2:57227268-57227290 GTGGGTCACAAGGGATATGATGG - Intergenic
932177795 2:69618802-69618824 GAGGGTGGCCATGGATGTGTAGG - Intronic
932921011 2:75915818-75915840 GAGGCTTTCCAGGTATTTGAAGG + Intergenic
933984404 2:87578581-87578603 GAGGGTAACTATGGATTTGGTGG - Intergenic
936309450 2:111372218-111372240 GAGGGTAACTATGGATTTGGTGG + Intergenic
940645758 2:156391475-156391497 GAGGATGAACAGGGATAAGAGGG - Intergenic
941086188 2:161121146-161121168 GAGGGGGAGCATGGATTTGAAGG - Intergenic
942814184 2:180033141-180033163 AAGGCTTTCCAGGGATTTGAAGG + Intergenic
945379667 2:209125321-209125343 GAGGGTGACTAGGACATTGAAGG - Intergenic
946080522 2:217114633-217114655 GAGGGTGGCTTGGAATTTGATGG - Intergenic
946427008 2:219604534-219604556 GAGAGTGACCAGGCATTTAATGG + Intronic
1170319518 20:15079652-15079674 GAGGGAGTCAAGGGAGTTGAGGG - Intronic
1172175481 20:32969691-32969713 AGGGGTGACCGGGTATTTGAGGG - Intergenic
1174625663 20:51912472-51912494 GAGGTTGACCAGGAGTTTGGTGG - Intergenic
1175314707 20:58039341-58039363 GAGGGTGAGGCGGGATTTCAGGG - Intergenic
1178949157 21:36971853-36971875 GAGGATAACCATGGATTTCATGG - Intronic
1178973628 21:37203248-37203270 GAGTCTGACCAGGGATCTCAGGG + Intergenic
1179288020 21:39994895-39994917 CAGGGTGACCCTGGCTTTGATGG + Intergenic
1179381517 21:40903502-40903524 GAGAATGGCCAGGGATTAGATGG - Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1183911560 22:41083244-41083266 CAGGGTGATCAGGAATTTGTGGG + Intergenic
1183972201 22:41485990-41486012 GAGGGCAACCAGGCATTTGCAGG - Intronic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
951677787 3:25261732-25261754 GTAGGTGACCAGGGAGATGAAGG - Intronic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952665234 3:35896073-35896095 GAGGATGACAAGGGTCTTGAAGG - Intergenic
953022215 3:39121955-39121977 GAGGGAAAGCATGGATTTGAGGG - Intronic
953912668 3:46900811-46900833 GAGGCTGAGCTGGGTTTTGAGGG + Intronic
954132367 3:48567171-48567193 CAGGGTGACCGAGGCTTTGACGG - Exonic
955048036 3:55378142-55378164 GAGAGTGACAGGGGATTAGATGG + Intergenic
955612784 3:60775513-60775535 GAGGGTGAGCAGGGTTTTATTGG - Intronic
956650681 3:71501843-71501865 GAGGGATACCAGGGTTTTCAGGG - Intronic
960044254 3:113180768-113180790 GAGGGGCCCCAGGGCTTTGAAGG - Intergenic
961802234 3:129460196-129460218 AAGGGTGAGTAGGTATTTGAAGG - Intronic
963320206 3:143802688-143802710 GAGGATGGTAAGGGATTTGAAGG - Intronic
963996074 3:151709923-151709945 GAGGCTTTCCAGGTATTTGAAGG - Intergenic
964688329 3:159422593-159422615 GAGGGTGGGCAGTGATTGGAAGG - Intronic
965011382 3:163096628-163096650 CAGGGTTCCTAGGGATTTGAGGG - Intergenic
965098926 3:164272265-164272287 GAAGGTGACCAGAGCTTGGAAGG + Intergenic
965848032 3:172987405-172987427 GAGAGTGACCCGGGATATGGTGG - Intronic
967410288 3:189160229-189160251 CAGGTTGACTAGAGATTTGATGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968591414 4:1461514-1461536 GAGGGTGAACAGGGAACAGAGGG + Intergenic
968878576 4:3286973-3286995 GATGGTGATCTGGGACTTGATGG + Intergenic
976209129 4:82649851-82649873 GAGGGTCACCGGGCCTTTGAAGG + Intronic
976485553 4:85599154-85599176 GAGGGAGAGGAGGGATTAGAAGG + Intronic
978282932 4:107038077-107038099 GATGGTTACCAGGAATTGGAAGG + Intronic
981537343 4:145813783-145813805 GATGGACAGCAGGGATTTGAGGG + Intronic
981568847 4:146130957-146130979 GCTGGTGACCAGGGAATTCATGG + Intergenic
983513772 4:168635808-168635830 GTGTGTGTCCAGGGATTTAAAGG + Intronic
983798766 4:171901171-171901193 GAGGGTGGGCAGGGATTTGCTGG - Intronic
984453820 4:179939323-179939345 GAAGGGGACAAGGGAGTTGAGGG + Intergenic
985373777 4:189313485-189313507 GAGAGGGACCAGAGATTTGTAGG - Intergenic
985702705 5:1383243-1383265 GAGGGTGAGCAGGGGGTTGGGGG - Intergenic
988244119 5:28655925-28655947 GGGGGTTACCAGGGATTAGAGGG - Intergenic
988992077 5:36680951-36680973 GAGGATGACCAGGGTTGGGAAGG + Intronic
991045225 5:62215483-62215505 GATGGTTACCAGGGACTGGATGG - Intergenic
994226357 5:97255212-97255234 AAGGCTGTCCAGGTATTTGAAGG - Intergenic
995169731 5:109093080-109093102 GATGGTTACCAGGGATTGCAAGG + Intronic
996262998 5:121497258-121497280 GAGGGTGAAAGAGGATTTGAAGG + Intergenic
996460993 5:123742954-123742976 GAGGGTCACCAAAGATTTCAGGG + Intergenic
996863230 5:128088412-128088434 GAGGGTAACAAAGTATTTGATGG + Intronic
998319444 5:141215619-141215641 GATGGAGACCAGGGATGTGAGGG - Exonic
998321432 5:141236050-141236072 GATGGAGACCAGGGAGGTGAGGG - Intergenic
999663097 5:153885988-153886010 AAGGAAGACCAGGGATGTGATGG + Intergenic
1001287950 5:170437464-170437486 GGGGGTGAGCAGAGATTTGAAGG - Intronic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1004320672 6:14629037-14629059 GAGGGTGACCAAGGAAGGGAGGG - Intergenic
1004332552 6:14735166-14735188 GGGGGTGACCAAGGATTTGGGGG - Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1004888135 6:20071314-20071336 GAGGGTGAGAAGGGAACTGAGGG - Intergenic
1005180455 6:23098453-23098475 GAGGGAGAAGAAGGATTTGAGGG - Intergenic
1006298027 6:33178713-33178735 TAGGGTGACCGAGGTTTTGATGG - Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007389048 6:41539393-41539415 GAGGGTGAGGTGGGATATGAAGG - Intergenic
1007940252 6:45774045-45774067 GAAGGTTTTCAGGGATTTGAAGG + Intergenic
1008702263 6:54115289-54115311 AAGGAGGACAAGGGATTTGAGGG + Intronic
1010826021 6:80476401-80476423 GATGGTGATCAGTGATTTGGAGG + Intergenic
1010977436 6:82331749-82331771 GAGGAAGTCCAGGGATTGGAGGG + Intergenic
1013365189 6:109432253-109432275 GAGGGTCAACAGGGATTTCTGGG + Intronic
1014186825 6:118444705-118444727 GAGGATTTCCAGGTATTTGAAGG + Intergenic
1017068737 6:150553030-150553052 GAGGAGCACCAGGGATTTTAGGG - Intergenic
1017156079 6:151323897-151323919 GTGGGTGATCTGGGATCTGAGGG - Intronic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018906349 6:168078569-168078591 GGGGGTGAGCAGGGCTGTGAGGG - Intronic
1019044524 6:169132813-169132835 AAGGATTTCCAGGGATTTGAAGG - Intergenic
1019478333 7:1254819-1254841 GGGGCTGACGAGGGATTCGAAGG + Intergenic
1019649490 7:2148995-2149017 ATGGGGGAGCAGGGATTTGAGGG - Intronic
1019849114 7:3537101-3537123 GAGGGATAACAGGGATTTAAGGG - Intronic
1020276892 7:6630082-6630104 GAGGGTGACCTGGTCTTTCACGG - Intergenic
1020800891 7:12730984-12731006 GAGGTTGACAAGGGTCTTGAAGG + Intergenic
1021200418 7:17722877-17722899 GAGGGTGACCTGTGATTTTCAGG - Intergenic
1022373196 7:29789300-29789322 GAGGATGATAAGGGATATGAAGG - Intergenic
1022530596 7:31064694-31064716 GAGGGTGACAAGAGATGTCAGGG - Intronic
1022547308 7:31201161-31201183 GAAGGTGACCAGGGACCTGGGGG - Intergenic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1024586980 7:50850261-50850283 GACTGTGACCTGGGCTTTGAAGG - Intergenic
1024601560 7:50986095-50986117 CAAGGTAACCAAGGATTTGAAGG - Intergenic
1028354201 7:89886785-89886807 GAGGATTTCCAGGTATTTGAAGG + Intergenic
1029270670 7:99375030-99375052 GAGGGAGCCCTGGGATTGGAGGG + Intronic
1032127625 7:129206254-129206276 GGTGGTGCCCAGGGCTTTGAAGG - Exonic
1034430985 7:151041055-151041077 GAGGGAGGCCAGGGATTCTAGGG - Intronic
1036212418 8:6853188-6853210 GAGGCTAAGCAGGGAGTTGATGG - Intergenic
1037254953 8:16942620-16942642 GAGGCTTTCCAGGTATTTGAAGG - Intergenic
1037574553 8:20188861-20188883 GTGGGTGACCAGGGAGTCTATGG + Intergenic
1039886174 8:41655183-41655205 GAGCGTCACCAGGGAGTCGAGGG + Intronic
1042428322 8:68674142-68674164 AAGGGTTTCCAGGTATTTGAGGG - Intronic
1043243161 8:77962373-77962395 GAAGGTGACCATGCTTTTGAGGG - Intergenic
1046258736 8:111737484-111737506 GAGGGTGACTTGGTATTCGAAGG + Intergenic
1046778901 8:118194333-118194355 GAGCCTGAGCAAGGATTTGAAGG + Intronic
1048609227 8:136003900-136003922 GAGTATGACCAGGGATCAGAGGG + Intergenic
1051336687 9:16071907-16071929 GAGGGGAAACAGGGATTTGGGGG - Intergenic
1051956344 9:22699707-22699729 GGGGGTGACCAGGGTAGTGAAGG + Intergenic
1052334228 9:27303451-27303473 GAGAATGACCAGGCATTTAAGGG + Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1053316781 9:37058813-37058835 GAGGCAGACCAGGGAGCTGAAGG - Intergenic
1056587856 9:87939980-87940002 GAGAGGGAGCAGGGATTAGAGGG + Intergenic
1056609011 9:88112965-88112987 GAGAGGGAGCAGGGATTAGAGGG - Intergenic
1058719087 9:107747350-107747372 GAGGATGAGGAGGGCTTTGAGGG + Intergenic
1058799046 9:108527018-108527040 GAGAGAGTCAAGGGATTTGAAGG - Intergenic
1060472682 9:123961605-123961627 GTGGGTGACCAGGGATTTGGGGG + Intergenic
1061400842 9:130367536-130367558 GAGGGTGACCAGGCAACTGGTGG - Intronic
1062106595 9:134758240-134758262 CAGGGTGACCGGGGTTTCGACGG + Exonic
1203792146 EBV:157506-157528 GAGGGTGCCCAGGGACTTCCCGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1190889159 X:54554058-54554080 AAGGGTGAGTAGGGATTAGAAGG + Intronic
1191998614 X:67123980-67124002 GAGGGTGAAGAGGGCTTTGGAGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1193786079 X:85760899-85760921 GAGGGAGACCAGAGGTGTGAGGG - Intergenic
1198746469 X:139896252-139896274 GAGGAAGACCAGGGAGGTGAAGG - Intronic
1199422492 X:147659915-147659937 GAGGGTGACCAGAGATGAAAGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201420636 Y:13794798-13794820 GAGGGTGACCTGGGAAGTCATGG - Intergenic